the top script defines the circle class with a radius property and two methods getarea and setarea the last statement instantiates a new object called mycircle of radius 10 the bottom script calls the setarea method for mycir

báo cáo hóa học: " The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial disease" potx

Ngày tải lên : 18/06/2014, 19:20

... the design and revised the manuscript critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript ... weakly associated with the Emotional and Pain domains (0.30 and 0.28) Table presents the correlations between the ALDS and the VascuQol scores on the one hand and decrease in ABI, resting ABI, ... JAR has been involved in the design of the study and interpretation of data, as well as in drafting the manuscript, MJWK was involved in interpretation of data and drafting the manuscript, DAL...

8
386
0

báo cáo hóa học:" The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial diseas" potx

Ngày tải lên : 20/06/2014, 16:20

... the design and revised the manuscript critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript ... weakly associated with the Emotional and Pain domains (0.30 and 0.28) Table presents the correlations between the ALDS and the VascuQol scores on the one hand and decrease in ABI, resting ABI, ... JAR has been involved in the design of the study and interpretation of data, as well as in drafting the manuscript, MJWK was involved in interpretation of data and drafting the manuscript, DAL...

8
335
0

Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot

Ngày tải lên : 14/03/2014, 16:20

... coleoid cephalopods and for developing a general scale for maturity staging for males and females Materials and Methods Details of the structure of the reproductive system of the Ommastrephidae squids ... Gonad is large, opaque and appear granular Oocytes are at intercalary and protoplasmic growth phase AG are completely formed and usually white Gonad is large, usually dullwhite Spermatozoa accumulate ... one large spermatophore is formed in the spermatophore gland and passed to the Needham sac Afterwards its contents appear in the hectocotylus cavity Spawning takes place with the transfer of the...

12
623
0

CASE STUDY OF COST SAVINGS WITH A NEW CHEMICAL MIXING SYSTEM AT MITSUBISHI PAPER HACHINOHE MILL PM7 potx

Ngày tải lên : 24/03/2014, 05:20

... Installation in October, 2008 Conclusion of installation in PM7 for CPAM & AKD ÜResults: PM7, additive savings after flash injection installed also for CPAM and AKD Filler content CPAM APAM AKD ... for papermaking additives Wetend Technologies Ltd is a Finland based corporation FiberLaboratory City of Savonlinna TrumpJet® Flash Mixing for papermaking additives 17 -Flash mixing takes place ... HeadBox Cleaner C-PAM MS P P CFP MFP Concept of laboratory test Simulation of conventional mixing points C-PAM before cleaner fan pump Simulation of new chemical mixing points C-PAM before A- PAM...

50
435
0

Báo cáo toán học: "On Mixed Codes with Covering Radius 1 and Minimum Distance 2" pot

Ngày tải lên : 07/08/2014, 15:22

... Qn with minimum distance d, and Kq (n, R), the minimal cardinality of a code C ⊂ Qn with covering radius R, see [2] q-ary codes with covering radius (at most) and minimum distance (at least) as ... 2) and certain generalized partial Latin rectangles A Latin square of order r is an r × r matrix with entries from a r-set R such that every element of R appears exactly once in every row and ... generalized partial Latin rectangle of order s × t and size m with entries from R corresponds to a code C ⊂ R × S × T of cardinality m with covering radius and minimum distance 2, and vice versa...

15
226
0

Báo cáo khoa học: "Whole shoot hydraulic resistance in Quercus species measured with a new high-pressure flowmeter" pps

Ngày tải lên : 08/08/2014, 23:22

... and Alexander, unpublished data) The leaf-blade resistance includes vascular and nonvascular pathways from the base of the leaves to mesophyll airspaces, but we are of the opinion that the main ... the applied water pressure, and A was the total leaf area of the shoots measured with a delta-T leaf area meter (Delta-T Devices Ltd, Cambridge, UK) at the end of the experiment Normalization of ... resistance to water flow is probably in the nonvascular part of the path (Tyree and Cheung, 1977) Leaf-blade resistances are relevant to a better understanding of stomatal physiology because they allow...

7
313
0

Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc

Ngày tải lên : 09/08/2014, 09:21

... linacs and adapted for image guidance and rotational therapy (the so -called Exact-IGRT couch top) Mechanical and Enhanced Dynamic Wedges were implemented on this new delivery platform as in other ... Details on the beam processing for AAA can be found in Fogliata et al [6] In summary, the AAA configuration phase consisted in the optimisation of parameters and calculation kernels against the ... delivery Tolerance on the acceptable deviation of each dose band generated with a given combination of the above parameters from the baseline (defined as average of all the dose bands) was set to...

29
344
0

báo cáo khoa học: "Chromosomal analysis of selected lines of Drosophila melanogaster with a new level of bristle canalization Eva" doc

Ngày tải lên : 09/08/2014, 22:22

... BBB average is not the same as that in every line in generation 44, because there are fewer individuals from class ; there is a slight increase of classes smaller than 2, and also of the classes ... BAB is also positionally decanalized in ADC-4 ; moresome individuals with more than e.b In ADC-7, BAB has some positional decanalization, and ABB is clearly positionally and numerically decanalized ... what about the canalization ? Apart from SC-1, which has no clear signs of decanalization but only signs of decrease of bristles, there are chromosomal combinations in the other lines that attract...

11
333
0

Báo cáo y học: " Predictors of metabolic monitoring among schizophrenia patients with a new episode of second-generation " docx

Ngày tải lên : 11/08/2014, 17:20

... interpretation of the results, and helped draft the manuscript Y-JC performed the statistical analyses, and participated in the design of the study, the analytical plan, and the interpretation of the results ... performed the additional statistical analyses and the interpretation of the results VF and DW participated in the design of the study, the analytical plan, the interpretation of the results, and ... extracted from the VISN 16 data warehouse Data format and content which was stripped of patient identifiers was in compliance with the Health Insurance Portability and Accountability Act (HIPAA)...

8
434
0

Báo cáo y học: " Tuberculosis contact investigation with a new, specific blood test in a low-incidence population containing a high proportion of BCG-vaccinated persons" pdf

Ngày tải lên : 12/08/2014, 16:20

... RD and TS designed the study and wrote the manuscript RD and AN carried out and interpreted the statistical analysis CL and MF participated in the design of the study and the data interpretation ... patients, obtained medical data and assessed results All authors read and approved the final manuscript Acknowledgements The authors would like to thank the staff of the office of TB control at ... which they were centrifuged and plasma harvested Plasma was kept refrigerated at 4–6°C until the ELISA was performed The IFN-γ ELISA was performed using the method recommended by the manufacturer...

9
434
0

Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx

Ngày tải lên : 22/06/2014, 22:20

... Riemannian p-homogeneous forms; we define a suitable notion of Kato class of measures We assume that the potential is a measure in the Kato class and we prove a Harnack inequality (on balls that are ... case of Laplacian and extended in [2] to the case of elliptic operators with bounded measurable coefficients Kato classes relative to a subelliptic Laplacian were defined in [3], and the case of ... Biroli and S Marchi 19 [9] J Mal´ and W P Ziemer, Fine Regularity of Solutions of Elliptic Partial Differential Equations, y vol 51 of Mathematical Surveys and Monographs, American Mathematical Society,...

19
326
0

Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"

Ngày tải lên : 31/10/2012, 17:03

... Tsybouleva N, Ballantyne CM, Gotto AM, Marian AJ Effects of PPARα, γ and δ haplotypes on plasma levels of lipids and progression of coronary atherosclerosis and response to statin therapy in the lipoprotein ... self-reported questionnaire and each case was validated by cardiac ultrasound and/ or electrocardiographic examinations or by coronary angiography Table 1: Patient characteristics n Age (years) BMI (kg/m²) ... characteristics for each group are presented in table Within the group of leaner patients there was a significantly higher incidence of coronary heart disease for carriers of at least one C allele...

4
568
0

systems with hysteresis. analysis_ identification and control using the bouc–wen model

Ngày tải lên : 12/12/2013, 22:41

... 4.7 Variation of x with the parameter ¯ values = and n = with the Figure 4.8 Variation of x with the parameter ¯ values = and n = with the 81 83 Figure 4.9 Variation of x with the parameter n with ... means that A n = ∅, which implies that A = A n = ∅ n The proof for the case with A > is now concluded with the characterization of classes I and II The cases A < and A = can be treated in a similar ... model parameters and a range for the initial condition z of the hysteretic part of the model The fact that A means that, for all classes, the A n n= boundedness of the hysteretic signal z t : (a) ...

223
525
1

Tất cả

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Ngày tải lên : 19/02/2014, 08:20

... GST-ExoS(L42 6A) 16 GST-ExoS(D42 7A) 17 GST-ExoS(L42 8A) 18 GST-ExoS(LD426–427AA) Amersham S419QGLLDALDL428 M419AAAA428 S419QGLLDAAAA428 S419QGLLAAAAA428 S419QGLLAALAL428 I419QGLLDALDL428 S419AGLLDALDL428 ... were then harvested and the resultant lysate was separated on a SDS ⁄ PAGE followed by immunoblotting with anti-Ras and anti-pan-Erk antibodies as a loading control (Fig 3D and E respectively) Ras ... evolution has created a new way to take advantage of an evolutionary ‘novel’ eukaryotic 14-3-3 protein family, using them as a necessary cofactor to activate lethal bacterial toxins, 644 but only after...

9
525
0

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21

... concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin ... Medical Research Council of Australia, the Australian Research Council, the National Heart Foundation of Australia (to RNP and AMB), Research Grants HL-06350 and HL-32656 from the National Institutes ... residues on the D- and H-helices and the heparin pentasaccharide are shown in ball and stick format in solution [21] This accelerates the interaction of AT with thrombin 100 0-fold and with fXa 10 000-fold...

10
668
0

The World with a Thousand Moons pdf

Ngày tải lên : 06/03/2014, 00:20

... elements He made up this formula, and tried it on a gravitation-paralysis case a space-man who's lain paralyzed for years The formula was designed to strengthen the human nervous system against the shock ... and the Sunsprite gyrated crazily in space There was a blood-chilling shriek of outrushing air from the fore part of the ship, and the slam-slam-slam of the automatic airdoors closing, down there ... air, Walls triggered his atom-pistol The crackling blast of force tore into the body of the charging asteroid-cat, and the beast fell heavily a few yards away But as it fell, the small gray mass...

52
408
0

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Ngày tải lên : 06/03/2014, 01:20

... using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and ... CGGTCACGAACTCCAGCAG, respectively The input of total RNA was lg A mixture containing total RNA, dNTPs (Invitrogen, Carlsbad, CA, USA) and pmol of each reverse primer was denatured at 70 °C for 10 and...

11
445
0

Đề tài " The distribution of integers with a divisor in a given interval " ppt

Ngày tải lên : 06/03/2014, 08:21

... conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy of Sciences Finally, the author ... order statistics The author also thanks G´rald Tenenbaum for several preprints of his work and for informe ing the author about the theorem of Rogers mentioned above, and thanks INTEGERS WITH A DIVISOR ... Y ) and ε(y, cy) c (log y)δ (log log y)3/2 Items (i)–(iv) of Theorem are trivial The ﬁrst and fourth part of item (v) are already known (cf the papers of Tenenbaum [42] and Hall and Tenenbaum...

68
409
0

COOPERATIVE STEWARDSHIP: Managing the Nation’s Multidisciplinary User Facilities for Research with Synchrotron Radiation, Neutrons, and High Magnetic Fields ppt

Ngày tải lên : 06/03/2014, 15:20

... (IPNS) at Argonne National Laboratory in 1981 and the Los Alamos Neutron Science Center (LANSCE) at Los Alamos National Laboratory in 1985 A new state -of -the- art spallation facility, called the Spallation ... University of Florida (Gainesville), and the Los Alamos National Laboratory The NHMFL also has a pulsed facility located in New Mexico at the Los Alamos National Laboratory DOE is the steward for two ... Physical Sciences, Mathematics, and Applications and was administered by the staff of its Board on Chemical Sciences and Technology in cooperation with that of the Board on Physics and Astronomy The...

86
346
0

Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

Ngày tải lên : 07/03/2014, 15:20

... cyanobacteria, corals and other marine organisms are much more advanced than those of mammals because photosynthetic organisms depend on solar irradiation as their primary source of energy, and ... the present investigation that the studied cyanobacteria are able to increase their MAA content in response to UV-B radiation and thus may be able to adapt to daily ﬂuctuations in solar radiation ... biological signiﬁcance of such DNA lesions depends on the capacity of the cell to repair the damage before it can be incorporated permanently into the genome Typically, DNA damage is repaired at a...

5
450
0