0

the stoichiometry of the reaction requires four equivalents of benzyl alcohol for every molecule of nitrobenzene however in order to achieve a higher conversion of the n

Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1

Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1

Cao đẳng - Đại học

... filtration after h) Figure 4-7 Reaction profile for the N- alkylation of aniline by benzyl alcohol in the presence of 2.4 wt % Ag/ Al2O3 () Aniline () N- benzylideneaniline () N- benzylaniline Reaction ... converted to lower and higher alkanes in contact with a combination of a dehydrogenation catalyst, platinum on alumina, and an olefin metathesis catalyst, tungsten oxide on silica [67] Basset and co-workers ... nanocluster and Ns in the reaction mixture Table 4-4 Scope of Ag catalyst on the N- Alkylation of amines with alcohols Table 4-5 Reaction studies and conditions in the N- alkylation of benzyl alcohols...
  • 221
  • 658
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Effect of the medical emergency team on long-term mortality following major surgery"

Y học thưởng thức

... patients underwent standard clinical assessment and management as routinely performed on incoming patients, including rapid stabilization of vital parameters, physical and neurological examination, ... maltophilia, sensitive to ofloxacin only Polymicrobial wound contamination also included contamination with fungi (for instance, Candida albicans as well as non-albicans species), and moulds that ... introducing new pathogens into an intensive care unit Initial anti-infective therapy using quinolones combined with clindamycin appeared useful and a good first-line choice Caregivers need to keep an...
  • 9
  • 761
  • 0
EFFECT OF THE NUMBER OF THE VERTICAL PIPES FOR THE PASSIVE AERATION ON THE COMPOSTING RATE

EFFECT OF THE NUMBER OF THE VERTICAL PIPES FOR THE PASSIVE AERATION ON THE COMPOSTING RATE

Môi trường

... International Winter Meeting of the American Society of Agricultural Engineers, American Society of Agricultural Engineers: Nashville TN Sartaj M., Fernandes L and Patni N K (1997) Performance of Forced, ... temperature over time for different composting runs Conversion of carbon of the three composting runs As the initial and final carbon contents in the composting raw materials were assessed on the ... International Development Research Center (IDRC), Ottawa, IDRC-TS8e, 7-13 Nagasaki K., Akakura N and Atsumi K (199 8a) Degradation Patterns of Organic Material in Batch and Fed-batch composting...
  • 8
  • 622
  • 1
Effect of the presence of coexisting substances on UV inactivation of Cryptosporidium parvum oocysts

Effect of the presence of coexisting substances on UV inactivation of Cryptosporidium parvum oocysts

Môi trường

... log10 inactivation of C parvum oocysts in excystation upon UV irradiation in the presence of kaoline Bars indicate the means from two independent experiments, and the lines indicate the maximum and ... inactivation in the excystation assay and 3.18 log10 inactivation in the animal infectivity assay) than in oocyst suspensions in pure water However, because the increase in potency was negligible, ... oocysts in excystation upon UV irradiation in the presence of humin Bars indicate the means from two independent experiments, and the lines indicate the maximum and minimum values Not Adherent Adherent...
  • 8
  • 358
  • 0
Tài liệu Báo cáo

Tài liệu Báo cáo "Effect of the preparation conditions on the properties of Fe-Pt nanoparticles produced by sonoelectrodeposition " pptx

Báo cáo khoa học

... broad peak on the DSC trace in the FePt nanoparticles suggests that there was no such transition in the FePt nanoparticles upon annealing The formation of the L10 FePt phase was N. H Luong et al ... Some of these beneficial effects include acceleration of mass transport, cleaning and degassing of the electrode surface, and an increased reaction rate [15] In this paper, we report the use of the ... sample was – 10 nm After annealing the particle size increased to 10 – 25 nm due to the aggregation and particle growth In addition, the size distribution of the annealed particles was larger than...
  • 7
  • 513
  • 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Báo cáo khoa học

... here as a nonspecific indicator of the binding effect, not as a direct measure of anion binding to the protein) for anions CD and absorption measurements In site 1, the K88E mutation introduces an ... located in segments of the polypeptide containing binding sites for polyanions, appear to play Anion-modulated structure of cyt c A- state a role in favoring protein folding into the native conformation; ... mechanism, but also indicates that the divalent anion– protein interaction favors in the macromolecule formation of noncovalent crosslinks and interlocked packing, which are important for stabilization...
  • 11
  • 487
  • 0
The effect of grammar teaching (syntax) in English on 5 to 16 year olds’ accuracy and quality in written composition potx

The effect of grammar teaching (syntax) in English on 5 to 16 year olds’ accuracy and quality in written composition potx

Kỹ năng viết tiếng Anh

... investigated the teaching of both sentence-combining and syntax One study focused on sentence-combining and punctuation; one on syntax, punctuation and sentence-diagramming; and one on punctuation alone ... investigated the teaching of both sentence-combining and syntax One study focused on sentence-combining and punctuation, one on syntax, punctuation and sentence-diagramming, and one on punctuation alone ... from whether teaching grammar improves writing, towards a different reason for teaching grammar, such as that as a strand in the teaching and learning of language it counts as another tool for developing...
  • 85
  • 700
  • 1
Gaza’s Children: FallinG Behind The eFFeCT oF The BloCkade on Child healTh in Gaza ppt

Gaza’s Children: FallinG Behind The eFFeCT oF The BloCkade on Child healTh in Gaza ppt

Sức khỏe trẻ em

... substantial health risks, including postpartum haemorrhage, infection and neonatal sepsis All of these medical conditions are “frequent” in Gaza and are a main cause of maternal and neonatal deaths.92 ... deaths among refugee infants (See UNRWA Infant Mortality Survey, “Causes and determinants of infant death among Palestine Refugees in the Near East”, 2009.) The Palestinian Central Bureau of ... in its entirety to enable the free movement of people and goods in and out of Gaza, including to the West Bank and East Jerusalem Recognising that relying on humanitarian assistance to mitigate...
  • 32
  • 425
  • 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Báo cáo khoa học

... GAGAAAAAGaaaaAAGATGGCAAAG-3¢) and DNA15RNA1-DNA13 (5¢-AATAGAGAAAAAGAAaAAAGATG GCAAAG-3¢) with a 1.5 molar equivalent of the complementary DNA, respectively, as described previously [10] In these sequences, DNA and ... Sc-RNase H2 have previously been analyzed by using various oligomeric substrates, including RNA20 ⁄ DNA20, DNA12-RNA4-DNA12 ⁄ DNA28, RNA13DNA27 ⁄ DNA40, DNA12-RNA1-DNA27 ⁄ DNA40, and RNA6-DNA38 ... 5¢-ATATGAA TTCTCTCTAAGGAGATATACTTATGACCGTTTCCAA CATTGGG-3¢ for RNH2B-F; 5¢-GGGGAAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC-3¢ for RNH2B-R; 5¢-ATATAAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG-3¢...
  • 14
  • 482
  • 0
the effect of the hydrothermal treatment with aqueous naoh solution on the photocatalytic and photoelectrochemical propertiesof visible light-responsive TiO2thin films

the effect of the hydrothermal treatment with aqueous naoh solution on the photocatalytic and photoelectrochemical propertiesof visible light-responsive TiO2thin films

Vật lý

... h), the nanowire structures start to be formed on Vis-TiO2 thin film accompanying the increase in the surface area, while the anodic photocurrent gradually decreases with the increase in the hydrothermal ... of the numerous stacking of nanowires with diameters of 30–50 nm can be observed, showing a remarkable contrast to the Vis-TiO2/Ti without hydrothermal treatment In addition, an increase in the ... changes of Vis-TiO2 thin films are not significant, while the drastic increase in the surface areas as well as the anodic photocurrents can be observed At the second stage (hydrothermal treatment...
  • 6
  • 489
  • 0
effect of the market on construction of music manufactured b

effect of the market on construction of music manufactured b

Kỹ năng viết tiếng Anh

... financial situation, the band have absolutely no say in what they want their sound to be like After the recording of the single (which, incidentally the band had no hand in picking), one of the ... excitement and being taken away by the St John's Ambulance Brigade .To create an image, the managers put the word out that the four boys from England's next Mega-band would be in such and such a place at ... audition lasting about as long as it took for the managers to discuss how the individuals looked Once the four boys had been trained by a voice trainer, the next step was to find material for them to...
  • 4
  • 338
  • 0
Gaza’s Children: FallinG Behind - The eFFeCT oF The BloCkade on Child health in Gaza ppt

Gaza’s Children: FallinG Behind - The eFFeCT oF The BloCkade on Child health in Gaza ppt

Sức khỏe trẻ em

... substantial health risks, including postpartum haemorrhage, infection and neonatal sepsis All of these medical conditions are “frequent” in Gaza and are a main cause of maternal and neonatal deaths.92 ... deaths among refugee infants (See UNRWA Infant Mortality Survey, “Causes and determinants of infant death among Palestine Refugees in the Near East”, 2009.) The Palestinian Central Bureau of ... in its entirety to enable the free movement of people and goods in and out of Gaza, including to the West Bank and East Jerusalem Recognising that relying on humanitarian assistance to mitigate...
  • 32
  • 453
  • 0
The Effect of the 2001 Tax Cut on Low- and Middle-Income Families and Children pdf

The Effect of the 2001 Tax Cut on Low- and Middle-Income Families and Children pdf

Ngân hàng - Tín dụng

... $200,000 and over Total Income Taxi Estate Taxii Percent of Change in Cumulative Total Income Total Tax Total Tax After-Tax Percentage of Percentage of and Estate Percentage of Change Change Incomeiv ... Reconciliation Act of 2001." National Tax Journal Giannarelli, Linda, and James Barsimantov 2000 "Child Care Expenses of America's Families." Washington, D.C.: The Urban Institute Assessing the New Federalism ... taxes (tables 6a and 6b) The marginal tax rate the amount of taxes due on an additional dollar of income—is a measure of a taxpayer’s incentive to work or save The EITC was designed to encourage...
  • 49
  • 425
  • 0
Báo cáo khoa học: Effect of mutations at Glu160 and Val198 on the thermostability of lactate oxidase doc

Báo cáo khoa học: Effect of mutations at Glu160 and Val198 on the thermostability of lactate oxidase doc

Báo cáo khoa học

... the atomic temperature factors averaged for the main-chain atoms of spinach glycolate oxidase [19] The data were obtained from the Protein Data Bank (entry ID: 1GOX) The average B-factor of each ... (Fig 4), the extension of the side-chain generated by the Val fi Ile mutation forms van der Waals contacts with the side-chain atoms of Thr128 or the main-chain atoms of Gly126 and Ala127 As residues ... with a bicinchoninic Protein Assay Regent Kit (Pierce) using purified bovine serum albumin as the standard Irreversible enzyme inactivation was measured at a protein concentration of 50 lgÆmL)1 in...
  • 6
  • 512
  • 0
Báo cáo khoa học: Analysis of the effect of potato carboxypeptidase inhibitor pro-sequence on the folding of the mature protein pot

Báo cáo khoa học: Analysis of the effect of potato carboxypeptidase inhibitor pro-sequence on the folding of the mature protein pot

Báo cáo khoa học

... constructs and mutagenesis A plasmid containing a synthetic gene encoding for the major isoform of PCI (IIa)[20] cloned into pINIII-OmpA3 vector [21], was used as a template to generate the plasmidic ... and the absorbance change at 330 nm was measured during min; then 10 lL of increasing concentrations of PCI or ProNtPCI were added and the measures were continued for The slope of the first part ... The ratio between the native form and the ensemble of scrambled species remains constant for all tested forms Therefore, in the absence of redox agents, neither the N- terminal nor the C-terminal...
  • 10
  • 458
  • 0
Báo cáo khoa học: Effect of the -Gly-3(S)-hydroxyprolyl-4(R)-hydroxyprolyltripeptide unit on the stability of collagen model peptides ppt

Báo cáo khoa học: Effect of the -Gly-3(S)-hydroxyprolyl-4(R)-hydroxyprolyltripeptide unit on the stability of collagen model peptides ppt

Báo cáo khoa học

... on the transition enthalpy Adding another also shows a further significant decrease of the transition enthalpy Further additions only lead to a minor Our new experimental data indicate that a ... than four repeating cycles of heating and cooling scans yielded overlapping curves, indicating that folding and unfolding is a reversible reaction under these conditions The transition temperatures ... of the heating and cooling scans were different with different scanning rates, but the scanning rate had no effect on the transition enthalpy for any peptide Figure shows the excess heat capacity...
  • 11
  • 601
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Effect of triplet multiple quantum well structures on the performance of blue phosphorescent organic light emitting diodes" potx

Hóa học - Dầu khí

... C, and D); TPBi (10 nm) as a TEBL and electron transporting layer [ETL]; 4,7-diphenyl-1,10-phenanthroline (BPhen, 30 nm) as an ETL; Liq (2 nm) as an electron injection layer; and aluminum (Al, ... excitons inside each EML and to manage triplet excitons by controlling the charge injection A stacked recombination zone structure, which can prevent triplet quenching processes and triplet exciton ... types of devices from one to four quantum wells are fabricated following the number of CCLs which are mixed p- and n- type materials, maintaining the thickness of the emitting layer [EML] Remarkably,...
  • 12
  • 417
  • 0
báo cáo hóa học:

báo cáo hóa học: " Imaging the effect of receptor for advanced glycation endproducts on angiogenic response to hindlimb ischemia in diabetes" docx

Hóa học - Dầu khí

... Femoral artery ligation Under isoflurane anesthesia, the hair on the abdominal wall and pelvis and both upper legs was shaved and the skin prepped with iodine and alcohol An incision was made on the ... Song J, Chow C, Jahanshad N, van Royen N, Buschmann I, Madri JA, Mendizabal M, Sinusas AJ: Noninvasive imaging of angiogenesis with a 99mTc-labeled peptide targeted at αvβ3 integrin after murine ... supported the scan findings There was positive staining for RAGE in the ischemic sections of hindlimbs from both diabetic and non-diabetic mice, and no staining in the contralateral control limbs...
  • 9
  • 398
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Effect of the carbon nanotube surface characteristics on the conductivity and dielectric constant of carbon nanotube/poly(vinylidene fluoride) composites" doc

Hóa học - Dầu khí

... work and carried out analysis and interpretation of the experimental results All authors read and approved the final manuscript Competing interests The authors declare that they have no competing ... should not have, on the other hand, a large influence in the electrical response [8] A change of several orders of magnitude of the electrical resistivity with increasing CNTs concentration was observed ... of the CNT due to the oxidation process, together with an increase of the surface area and defect formation, is at the origin of the observed effects Abbreviations CNT: carbon nanotubes; DMF: N, ...
  • 5
  • 353
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Effect of the Nd content on the structural and photoluminescence properties of silicon-rich silicon dioxide thin film" pdf

Hóa học - Dầu khí

... explained by the increase of the Si-np density as well as the increase of non-radiative de-excitation channels of both Si-np and Nd3+ The Nd3 + PL intensity is then maximal after annealing at ... integrated PL intensity of the Sinp PL band and the 920-nm PL peak is shown in the inset of Figure The enhancement of the PL intensity of the broad visible PL band with the annealing temperature ... 2a shows the evolution of the positions of the LO3 and TO3 vibration modes, and the LO3 /TO3 intensity ratio, as a function of the annealing temperature One can observe that, while the annealing...
  • 8
  • 474
  • 0

Xem thêm