the speed of light is greater in a vacuum than in air or water
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot
... Program, Laboratory of Pathology, National CancerInstitute, National Institutes of Health, Bethesda, MD 20892, USAFull list of author information is available at the end of the articleTakikita ... HNSCC and is a potential candidate molecule for targeted therapy.Background The majority of tumors that arise in the head and neckregion are s quamous cell carcin omas arising from the upper aerodigestive ... immunohistochemistry for Her2 (a, membranous staining and Her3 (b, membranous andcytoplasmic staining, and c, predominant cytoplasmic staining) 400 × magnification.Takikita et al. Journal of Translational...
- 10
- 490
- 0
báo cáo hóa học:" Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" doc
... equally1Tissue Array Research Program, Laboratory of Pathology, National CancerInstitute, National Institutes of Health, Bethesda, MD 20892, USAFull list of author information is available at ... Research Program, Laboratory of Pathology, National CancerInstitute, National Institutes of Health, Bethesda, MD 20892, USA.2AppliedMolecular Pathology Laboratory, Laboratory of Pathology, National ... HealthSystem and office of Human Subjects Research at the NIH. Information on post-operative radiation and /or chemotherapy, a nd performance status of patients wasunavailable for analysis.Tissue...
- 10
- 479
- 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... simulation A mathematical model was developed, representing centralcarbohydrate metabolism in leaves of A. thaliana. The model was based on the following system of ordinary dif-ferential equations ... differences in cold-induced reprogramming of central carbohydratemetabolism. Mathematical modelling of metabolismwith respect to the dynamics of freezing tolerancerevealed a significant correlation of ... engineering of freezing tolerance in plants should include such ananalysis of the dynamics of metabolism to gain com-prehensive information about the effects of individualoverexpression or...
- 13
- 707
- 0
Tài liệu Why Has the Cost of Fixed-Wing Aircraft Risen - A Macroscopic Examination of the Trends in U.S. Military Aircraft Costs over the Past Several Decades pptx
... aircraftNASA National Aeronautics and Space AdministrationNATO North Atlantic Treaty OrganizationNAVAIR Naval Air Systems CommandNGC Northrop Grumman CorporationOPNAV Office of the Chief of ... next explore the sources of escalation within a single aircraft program at a more detailed level, such as the airframe, propulsion, or avionics. For example, in earlier analyses of naval ship ... use of labor and tooling when production rates are higher.When considering comparison pairs of aircraft, we found that complexity of the aircraft (performance characteristics and airframe material)...
- 118
- 543
- 0
Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf
... Ultimately, the ophthalmologist and internistshould increase their awareness and understanding of TB and its possible ocular involvement because the dis-ease is curable and blindness is preventable ... tuberculosis, Prevalence, Anti-tubercular therapy, Extra-pulmonary TB, Anterior uveitis,Posterior uveitisBackgroundAccording to the World Health Organization, the Philippines ranks fourth in the world ... yearly [1], making it a major public health concern in the country. TB in the Philippines ranked fifth in the 10leading causes of death and fifth in the 10 leading causes of illness, with an incidence...
- 4
- 517
- 0
The Risk of Obstructive Lung Disease by Previous Pulmonary Tuberculosis in a Country with Intermediate Burden of Tuberculosis potx
... categorized the TB lesion of each subject as mini-mal, moderately advanced, or far-advanced, based on the clas-sication of the National Tuberculosis and Respiratory Disease Association of ... require three or more acceptable curves for an adequate test, this is not practical for a large-scale exami-nation survey, so we analyzed only the data of subjects with two or more acceptable spirometry ... 2001 by the Korea Institute for Health and So-cial A airs. Based on the 2000 Population Census of the Nation-al Statistical Oce of Korea, a stratied, multi-stage, clustered, probability...
- 6
- 441
- 0
What is the impact of microfinance on poor people? a sysTemaTic review of evidence from sub-saharan africa pptx
... Financial Sector Deepening Trusts in Kenya and TanzaniaGHAMFIN Ghana Microfinance Institutions NetworkILO International Labour OrganisationINAFI International Network of Alternative Financial ... List of AbbreviAtions3ie International Initiative for Impact EvaluationAEMI Association of Ethiopian Microfinance InstitutionsAFMIN African Microfinance NetworkAIMS Assessing the Impact of ... studies included in the in- depth synthesis 85Appendix 4.2: Narrative synthesis of findings relating to the impact of microfinance on the wealth of the poor 89Appendix 4.3: Narrative synthesis of...
- 104
- 546
- 0
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot
... concentrations of PD98059 (MEK1 inhibitor) and G F109203X (proteinkinase C inhibitor) indicating that each of these pathwayshas a modulatory r ather than a mandatory role to play in mediating the ... that activation of P tdIns 3-kinase is the key regulatory step in the proliferative p athwayand that each of the other pathways interacts with thispathway with the magnitude of the cellular ... was thenseparated a nd quantified by thin layer chromatographyusing a solvent system containing chloroform/methanol/ammonia /water (20 : 15 : 3 : 5, v/v/v/v) and autoradiog-raphy;32P incorporation...
- 10
- 437
- 0
Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx
... Ala-Ala-Val-Ala-pNA or Ala-Pro-pNA, exhibiting precisely the sequence of FRAP-TGase.Yellowing of the Ala-Ala-Val-Ala-pNA solution must be the result of direct cleavage of the anilide bond. Ala-pNAand ... aminopeptidase is therefore logical. However, a side reaction with the tetrapeptide Ala-Ala-Val-Ala-pNA was revealed. The inability of the peptidase to hydrolyse Ala-Ala-pNA andAla-pNA (or other chromogenic ... distinct differ-entiation stages. Culture on agar plates containing glucose,yeast and malt extracts allows the organism to developsubstrate and aerial mycelia culminating in the formation of spores...
- 7
- 480
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... microsatel-lite is also related to inflammatory diseases such as atopy[28], asthma [29], and rheumatoid arthritis [15]. Finally, the correlation of the -173 C allele and the -794 CATT7allele as ... calculations,coordinated the study and drafted the manuscript. Allauthors read and approved the final manuscriptAcknowledgements The authors would like to thank Sabine Mering for expert technical assist-ance ... for single marker analysis. Statistical significancewas assumed at p < 0.05. Statistical power (1-β) was calcu-lated using binominal power calculation. The power cal-culation for the -173...
- 8
- 554
- 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... +10GCGGGTTCAAAAACTACTATAGGTAGGCAG DrosophilaTGCCTTATATGTTCGTCTGTAGGAGCGAGT ChickenGCATGTGCGGGCAGGAAGGTAGGGGAAGAC XenopusTATTGTACCTGGAGATATATGCTGACACGC RatTATTGGACCTGGAGATAGGTACTGACACGC MouseTTTGGGCCGCCGGGTTATATGCTGACACGC ... 1960(1851)TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGGcanus fam EcoRI BamHI (1809)TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGGpK9 ... bp)bla a IISV40pICaninepIICMVoritICGACCT CCGAAGTT GGGGGGGAG AGT CTT CT CGA GT AGAAG ACC GA CCT ACCT GGCAACAAAAAAT GTGCTGGAGGCTT CAACC CCC CCTCT CAGAAGAGCT CAT CT TC TGGCT GGATGGACCGTTGTTTTTTACAtIBbsI...
- 12
- 567
- 0
báo cáo hóa học: " Too much or too little step width variability is associated with a fall history in older persons who walk at or near normal gait speed" pdf
... report the number of falls in the past year.Data AnalysisPrior to data analyses the gait variability data were exam-ined for normality. The gait variability data were relativelynormally distributed ... analyzed the data, and drafted the manuscript. JEB participated in the data analyses andmanuscript preparation. JVS participated in the design of the study, data analyses, and writing the manuscript. ... be at risk for falls by their gait speed (i.e. those walking at a near normal gait speed) variability of step width may provide valuable information about fallrisk. In people walking at a near...
- 8
- 402
- 0
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf
... 1960(1851)TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGGcanus fam EcoRI BamHI (1809)TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGGpK9 ... ChickenGCATGTGCGGGCAGGAAGGTAGGGGAAGAC XenopusTATTGTACCTGGAGATATATGCTGACACGC RatTATTGGACCTGGAGATAGGTACTGACACGC MouseTTTGGGCCGCCGGGTTATATGCTGACACGC HumanTTTTTTGTTGCCAGGTAGGTGCTGACACGT MDCKDetermination ... bp)bla a IISV40pICaninepIICMVoritICGACCT CCGAAGTT GGGGGGGAG AGT CTT CT CGA GT AGAAG ACC GA CCT ACCT GGCAACAAAAAAT GTGCTGGAGGCTT CAACC CCC CCTCT CAGAAGAGCT CAT CT TC TGGCT GGATGGACCGTTGTTTTTTACAtIBbsI XhoI BbsIpIEvaluation...
- 12
- 627
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25