the scrollbar component controls the scrolling of a text field
báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx
... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization of ... by the magnetic field However, for a larger value of the wavevector, the wavefunctions are only weakly affected by the field, due to the strong localization of the states Figure displays the ... to the states that are indicated by arrows in panel (a) (a) (b) Figure Energy levels of a single kink profile in bilayer graphene as function of external magnetic field B0 with the same parameters...
- 10
- 471
- 0
Báo cáo y học: "Cough: meeting the needs of a growing field" ppt
... the other hand, is a rather different kettle of fish It can arbitrarily be defined as lasting longer than eight weeks but by the time these patients reach the specialist cough centre, they have ... sensitivity as measured by capsaicin or citric acid challenge Such fundamental research raises the hope of an improved understanding of the cough reflex and its sensitisation and ultimately better target ... Yet there is little evidence that proton pump inhibitors and nasal steroids have any real sustained benefit in the treatment of acid- and postnasal drip-associated cough Sedating antihistamines...
- 2
- 177
- 0
Báo cáo toán học: "Coloring the edges of a random graph without a monochromatic giant component" doc
... graph Then the theorem states that a. a.s a linear-sized ‘giant component emerges quite precisely at the point where the average degree in the graph is In the past decades, much research has ... Bohman, A Frieze, and N Wormald Avoidance of a giant component in half the edge set of a random graph Random Structures Algorithms, 25(4):432–449, 2004 [5] T Bohman and J H Kim A phase transition ... that for any c > 1.5, a random 3-vertex-coloring of Gn,cn yields a giant component a. a.s On the other hand, Achlioptas and Molloy [1] showed that a. a.s Gn,cn can be properly 3-colored as long as...
- 7
- 226
- 0
standard specification for producing a skid-resistant surface on concrete by the use of a multi-component epoxy s
... the proposed aggregate and coating at their proposed rate of application prior to publication of a specification will enable the designer to anticipate the appearance and texture of the surface ... rate of aggregate application is suitable for the aggregate gradation specified in Article 2.2.2.1 and coating rate of application specified in Article 2.3.4.1 If either of these is changed the ... in Article 2.3.4.2 If either of these is changed the coating application rate may have to be adjusted A sample should be prepared to evaluate the resulting surface, 2.3.4.2 Aggregate application...
- 6
- 242
- 0
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC Trk1-Seq-F1 ACAAAGACAGCACCAACAGA Trk1-Seq-R1 GAAGTAGTGAACCGCGATAA Trk1-Seq-F2 TGGATCGTGCAATTATCTTG Trk1-Seq-R2 AAGGCGATTAAGTTGGGTAA ... potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in DNA manipulation, available ... channels and are strongly regulated by voltage They are active at the plasma membrane as inward, weakly-inward and outward channels The KCO family does not have voltage sensor domains as in Shaker family,...
- 109
- 382
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...
- 23
- 1,290
- 1
List the components of a radio system
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Objectives • List the components of a radio system • Describe how different factors affect the design of a radio system • Explain the radio frequency spectrum Components of a Radio System • Components...
- 30
- 920
- 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...
- 386
- 1,222
- 4
Guest the meaning of a word
... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...
- 2
- 871
- 1
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...
- 6
- 692
- 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... engages mainly in the industry of household appliances, as well as the domains of real estate and logistics The group is also one of the largest manufacturing and exportation bases of electric appliances ... Generally, if possible, it is wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade ... days after of the buyer’s advice ARTICLE 8: ARBITRATION During the performance of the contract, if any dispute arises, the parties shall discuss to find solution in an amicable way If the parties...
- 41
- 614
- 0
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater
... water ascends to the top of the tank It is originated from the fact that, after gaining heat from the solar radiation, the tank wall heats a thin vertical layer of water along the tank wall Part ... function of the density, specific heat capacity and the initial and massweighted average temperatures of water; with all the values, apart from the mass-weighted average temperature, are the same ... solar radiation and average temperature of the present experimental study and the theoretical results of [1] in January Figure 12 The time variation of solar radiation and stored energy of the...
- 12
- 520
- 1
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...
- 23
- 552
- 0
Tài liệu The message of a master - By John McDonald pdf
... the great masses of humanity are using the Law destructively, or partially so, and the scales are balanced against them Here and there, among the masses, we find an occasional outstanding figure ... inferior creatures as the beasts of the field, the birds of the air and the fish of the sea are bountifully supplied For any man, no matter what his station in life, to take the stand that it is the ... we know what we are talking about when we speak of the chaos of thoughts in the air http://www.RetrieveALover.com Page 33 The Message of a Master On the other hand, the man who has a set definite...
- 50
- 861
- 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, in the book The Experience Economy (1999), authors ... mirrors the myriads of interactions taking place in a company and the value created in each of them The problem is not the amount of relationships since firms have the help of sophisticated information ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar...
- 15
- 796
- 0
Tài liệu Exporting the Results of a Query as a String docx
... is the TAB character rowDelimiter The character or characters that separate rows The default value is the CARRIAGE RETURN character nullExpr A string that is substituted for null column values ... If a number larger than the number of records in the table is specified, all records are converted without error columnDelimiter The character or characters that separate columns The default value ... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dt = new DataTable(ORDERS_TABLE); da.Fill(dt); // Call method to convert the DataTable to a string resultTextBox .Text = GetString(dt, -1, null, null, null); } private String...
- 4
- 388
- 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The ... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...
- 8
- 517
- 1
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx
... (Silk & Kawani, 1982) Therefore, it can be argued that the aggregate satisfaction of the buying organization is a rather complex function of satisfactions of individual, from an importance viewpoint, ... and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... clearly consider CSM as an activity that is based on standardized questionnaires that are delivered to a sample of the customer base These quantitative multi-attribute questionnaires are then analyzed...
- 37
- 1,063
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... with their work The results are valued on a Likert scale of to for the different items Over the last few years, the average satisfaction index—calculated as the average of the values given to each ... be measured via these same factors, even if the individual case is a strategy for which new tools are used The analysis revealed that one of the essential organizational factors, because of its ... Irizar Brazil and Irizar Mexico, with a shareholding in International Hispacold, all to be able to service the growing demand in these markets At the same time, a systematic application of KM was...
- 10
- 1,063
- 1
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25