the scattered radiation create a loss of contrast and definition often secondary radiation is thought of as radiation striking the film reflected from
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps
... 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, ... fusion was measured for each of the mutants by calculating their relative luciferase enzyme activity compared to WT The relative luciferase activity for each of the mutants was averaged from three ... motif and those containing the Y712C mutation The MFI Index value was calculated for each of the samples The results indicate that all of the Env CD mutants maintained at least WT levels of surface...
- 17
- 362
- 0
NUPOS: A part of speech tag set for written English from Chaucer to the present ppt
... text corpora what it “learned” from the training set The “knowledge” of the automatic tagger may consist of a set of rules or of a statistical analysis of the results Either way, a good tagger will ... very atomic fashion in a relational database so that a given word can be retrieved as an instance of any of its grammatical properties, separately or in combination A Greek word can be adequately ... pose a separate problem The standard adverbial form of an adjective uses a -ly suffix But there is a class of spatial adjectives that use an ‘-s’ suffix (‘downwards’) There is also a zero form of...
- 25
- 516
- 0
Báo cáo y học: " The utility of the Historical Clinical Risk -20 Scale as a predictor of outcomes in decisions to transfer patients from high to lower levels of security-A UK perspective" pptx
... in cases of murder, manslaughter, assault, rape, indecent assault towards adult male, adult female or child, robbery and arson, based on the criteria of Bailey and MacCulloch [22] Data analysis ... Figure Area under curve: Historical, clinical and risk subscale as well as total HCR-20 score as a predictor of the outcome “failure” medium secure psychiatric care As far as we know this is the ... performance indicators In recent years, there has been a move away from reliance on criminal outcomes alone and recent work suggests alternative measures such as readmission and collateral and self...
- 8
- 388
- 0
A study of conversational implicatures in titanic film
... of use” Speakers having a conversation are viewed as taking turns at conversational implicature in Vietnamese as well as in many other holding the floor The structure of talking, the basis patterns ... Jack and Rose, the two main characters in the film Titanic Then, this study also reveals significant finding that may contribute to the theory of implicature and its applications in as much as ... instead of an utterance’s meaning complex and paradoxical way Therefore, work with film can affect Conversational implicature is one of the most important ideas in students in positive and valuable...
- 13
- 920
- 3
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx
... many examples of people who choose to follow this path and each of them has been able to achieve the joy and happiness that is seek FEAR Fear is a characteristic of our ego Our ego has a great ... comparisons between holographic creation and visualization are based in the fact that there is no such thing as time As Robert Anthony said in the quote at the start of this chapter, The only ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently...
- 59
- 770
- 3
Báo cáo khoa học: "Measurement and modelling of the photosynthetically active radiation transmitted in a canopy of maritime pine P Hassika" doc
... one facing upward and the other downward, measured the global PAR and the reflected PAR On the same site, at m above the ground and at the top of the scaffolding, two cells locally measured the ... This The was Experimental measurements Figure I shows the different terms of the radiation balance in the PAR above and below the canopy for clear weather (day 193) as a function of the hour of ... days) the measurement of the lower diffuse PAR was missing, whereas for days 187, 188, 191 and 194-198 the measurement of the lower global Lastly, PAR was missing The direct PAR above the canopy...
- 16
- 299
- 0
Báo cáo lâm nghiệp: " A comparison of the photosynthetic radiation response of Scots pine shoots in direct and diffuse radiation" pot
... distribution of radiation over the shoot In Fig 2A, the photosynthetic rate of a shoot in direct radiation is calculated based on the simulated irradiance distribution on the needle surface area and a photosynthetic ... however, the rate of photosynthesis per unit of intercepted radiation was still clearly higher (Fig A) , indicating that the more even distribution of radiation in the case of diffuse radiation is an ... and diffuse radiation When the radiation is expressed in terms of horizontal photon irradiance (Fig 1A) , the difference is exaggerated because, at an equal horizontal irradiance, the amount of...
- 4
- 269
- 0
Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot
... analysis J-PR contributed to study design, acquisition of data, analysis and interpretation of data, and statistical analysis M-JB and FA contributed to acquisition of data and to analysis and ... condyle at the anterior and posterior areas and for the lateral tibial plateau at the anterior area further explore the risk factors that are selectively associated with more rapid disease progression, ... central areas of the medial compartment as they presented the greatest loss of cartilage volume and were therefore the areas of the most significance (Table 3) From the baseline demographic characteristics,...
- 11
- 518
- 0
Báo cáo khoa học: " Optimal organ-sparing intensity-modulated radiation therapy (IMRT) regimen for the treatment of locally advanced anal canal carcinoma: a comparison of conventional and IMRT plans" ppsx
... N2-3/T4 group Arm A, blue; arm B, brown; arm C, yellow; arm D, green Discussion Concurrent chemoradiation is the established standard of care for locally advanced carcinoma of the anal canal Attempts ... treatment (arms C and D) is feasible and reduces threshold radiation doses to the small bowel, bladder, genitalia and femoral heads as compared to conventional AP/PA plans with 3D conformal boost The ... Gonzalez DG, Peiffert D, van Glabbeke M, Pierart M: Concomitant radiotherapy and chemotherapy is superior to radiotherapy alone in the treatment of locally advanced anal cancer: results of a Page...
- 11
- 402
- 0
báo cáo khoa học: " Behavioral changes of patients after orthognathic surgery develop on the basis of the loss of vomeronasal organ: a hypothesis" pptx
... in the course of dissecting the nasal mucosa from the hard palate osseous base As a result of this surgical intervention, the patient loses the ability to recognize all scents of a pheromone nature, ... separately from those who underwent a sagittal split osteotomy of the mandible and/ or a genioplasty without maxillary advancement and/ or set back Conclusion Our hypothesis presumes that the loss of ... Ellis E 3rd, Sinn DP: Comparison of habitual masticatory cycles and muscle activity before and after orthognathic surgery J Oral Maxillofac Surg 1997, 55:699-707 Cuccia AM, Campisi G, Cannavale...
- 5
- 334
- 0
Báo cáo y học: "The loss of health status in rheumatoid arthritis and the effect of biologic therapy: a longitudinal observational study" pot
... in RA is indistinguishable from population normative data No population normative data are available for the HAQ, but its pattern of loss is similar to that of PCS and EQ-5D These data can be ... very early in RA Our data suggest that there might be a substantial disconnect between damage and health status, and that pain and difficulty and uncertainty, the burden of RA, may impact measured ... helped in the drafting of the manuscript, and participated in the conception, design, data collection, and data analysis of the study All authors read and approved the final version of the manuscript...
- 12
- 385
- 0
Báo cáo y học: "A general framework for quantifying the effects of DNA repair inhibitors on radiation sensitivity as a function of dose" pptx
... i is an indicator which assumes the value zero for the control case, i.e radiation alone, and one for the drug-treated case; and δx – where "x" is any of the parameters above – is the variation ... comparison of the parameters in the treated and untreated experiments As a consequence, quantitative assessment of the effect of modifiers of DNA repair upon four distinct components of the radiation ... observation that δz was a significant parameter in all cases, and that the magnitude and direction of this effect varied according to cell line and confluence, suggests that this variable is an...
- 7
- 320
- 0
A STUDY ON HOW SCRIPTWRITERS FLOUT CERTAIN MAXIMS OF GRICE’S COOPERATIVE PRINCIPLE TO CREATE VERBAL IRONY THROUGH THE SITCOM FRIENDS FROM EPISODE 1 TO EPISODE 10
... Wikipedia defines dramatic irony as ―device of giving the spectator an item of information that at least one of the characters in the narrative is unaware of (at least consciously), thus placing the ... does he have a hump? A hump and a hairpiece? The mechanism in which irony is generated in this situation can be analyzed as follows: (i) Chandler has asked Monica whether the man Monica is going ... Monica is going out with is an abnormal man (ix) Therefore, in asking whether the man Monica is going out with has a hump and a hairpiece, Chandler has implicated the question whether he is a very...
- 91
- 880
- 0
A STUDY ON HOW SCRIPTWRITERS FLOUT CERTAIN MAXIMS OF GRICE’S COOPERATIVE PRINCIPLE TO CREATE VERBAL IRONY THROUGH THE SITCOM FRIENDS FROM EPISODE 1 TO EPISODE 10
... which flout the maxim of quality 36 2.3.1.2 The analysis on situations which flout the maxim of quantity 49 2.3.1.3 The analysis on situations which flout the maxim of relation ... VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST-GRADUATE PROGRAM ĐÀO THỊ VÂN HỒNG A STUDY ON HOW SCRIPTWRITERS FLOUT CERTAIN MAXIMS OF GRICE’S ... Conversational maxims 1.2.1.1 The maxim of quality 1.2.1.2 The maxim of quantity 1.2.1.3 The maxim of relation 10 1.2.1.4 The maxim of manner ...
- 5
- 599
- 4
A study on how scriptwriters flout certain maxims of Grice's cooperative principle to create verbal irony through the sitcom Friends from episode 1 to 10
... necessary to provide an explanation for the choice of analyzing the scripts of the sitcom “Friends” According to Alison, “although British comedy has a high reputation and used to claim a higher ... It was even so popular that it was rerun in 1997 as the beginning of Channel 4‟s night of comedy The success of the series can be attributable to many factors, among which, the great potential ... be able to deal with the cultural differences when analyzing ironic dialogues because of the limit of time although is also clear that, in many cases, the fact that people in non-English speaking...
- 7
- 457
- 0
Howto Books The A-Z Of Correct English
... asma or assma) astrology or astronomy? ASTROLOGY is the study of the influence of the stars and planets on human life and fortune ASTRONOMY is the scientific study of the stars and planets athlete ... athelete) athletics (not atheletics) 22 ASTHMA ASTHMA AXIS attached, attaching, attachment (not -tch) audible (not -able) audience (not -ance) aural or oral? AURAL refers to the ears and hearing ... Use CASTE when referring to a social group in Hindu society caster or castor? Both caster sugar and castor sugar are correct Both sugar caster and sugar castor are correct Both casters and castors...
- 203
- 785
- 6
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... Information access and management is an area of great activity, given the rise in popularity of the Internet and the explosion of data available to users It is the application area that this thesis ... generally agreed upon, open standards JAVA itself is not an agent-application Yet, the Java Agent Template is available which "provides basic agent functionality packaged as a Java application This ... approach the superhighway at all A draw-back of tour guides and indexing agents is that their actions and suggestions are based on a relatively weak model of what the user wants and what information...
- 100
- 811
- 3
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of the ... preparation The bleeding was controlled by #3-0 Vycryl intracorporeal suture, and the invagination of the diverticulum was performed laparoscopically The recovery was uneventful, and the patient ... preliminary findings Am J Gastroenterol 1997;92:924-8 Parks TG Natural history of diverticular disease of the colon Clin Gastroenterol 1975;4:53-69 West BA The pathology of diverticulosis: classical...
- 3
- 531
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
... our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare ... kidney disease Pediatrics 2002; 110: e13 19 Aarhus M, Helland CA, Lund-Johansen M, et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid ... associated with the pathogenesis of temporal fossa AC Helland et al 20 found the Na+–K+–2Cl− cotransporter NKCC1 gene was escalated in AC and NKCC1 was present in the AC wall These finding indicated NKCC1...
- 4
- 652
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008