the role of the textbook in a language program

Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

Ngày tải lên : 21/02/2014, 20:20
... specif i c a l l y in agrammatics and Broca's aphasics French neurolinguistic studies have documented a similar degradation in the a b i l i t y of agrammatic and Broca's aphasics (LeCours and Lhermitte, ... REFRACTORY-STATE-ACTIVATION: An automatic change of state that occurs after active information has reached threshold and fired In this state the information can not affect or be affected by other information in the system ... occur and affect the state of the process The most important aspect of the control is that a l l of the serial order computations can occur simultaneously and affect any information that has been...
  • 5
  • 609
  • 0
The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

Ngày tải lên : 13/10/2015, 16:41
... known as PYCARD, which consists of an N-terminal PYD domain and a C-terminal caspase activation and recruitment domain (CARD) that is necessary for the binding of caspase-1 to the inflammasome (Martinon ... caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase-1, caspase-4, caspase-5, caspase-11 and caspase-12) activates crucial mediators ... (PFU/ml) during an infection of RAW264.7 macrophages 65 3.1.6 Evaluation of influenza A infection of RAW264.7 murine macrophages 66 3.2 AN INVESTIGATION OF THE ROLE OF CASPASE-1 IN AN IN VIVO...
  • 190
  • 824
  • 0
The changing role of managerial accounting in a dynamic business environment

The changing role of managerial accounting in a dynamic business environment

Ngày tải lên : 05/12/2016, 17:29
... Financial Accounting Accounting Accounting System System (accumulates (accumulates financial financial and and managerial managerial accounting accounting data data in in the the cost cost accounting ... making making and and planning planning •• Assisting Assisting managers managers in in directing directing and and controlling controlling activities activities •• Motivating Motivating managers ... Supervising Supervising accounting accounting personnel personnel –– Preparation Preparation of of information information and and reports, reports, managerial managerial and and financial financial...
  • 31
  • 433
  • 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Ngày tải lên : 15/02/2014, 13:20
... States This vaccine was transferred from a strain that was maintained at the University of Montreal (Montreal, Canada) Vaccine Efficacy Reported rates of the protective efficacy of BCG vaccines ... National Association of State Public Health Veterinarians Keith A Clark, D.V.M., Ph.D Texas Department of Health Austin, TX National Vaccine Program Anthony Robbins, M.D Office of the Assistant ... regarding the risks and benefits associated with both BCG vaccination and TB preventive therapy They should be informed about a) the variable data regarding the efficacy of BCG vaccination, b) the...
  • 27
  • 1.3K
  • 3
Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt

Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt

Ngày tải lên : 18/02/2014, 08:20
... were maintained in a hypoxia chamber (Invivo 400; Ruskinn Inc., Cincinnati, OH, USA) constantly maintained at 1% O2 Culture medium was replaced every other day inside the chamber For miRNA transfection, ... described in (A) Total RNA was prepared at the indicated times and subjected to quantitative real-time PCR analysis The data shown are mean value ± standard errors of the mean from three independent ... as described in Fig For hypoxia treatment, 3T3-L1 cells were placed in a hypoxia incubator with 1% O2 immediately after addition of the IDM cocktail The control was maintained in a standard incubator...
  • 11
  • 848
  • 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Ngày tải lên : 06/03/2014, 08:20
... enterprises, as well as the actual constraints exerted by the structure of a balance sheet are still limited, a qualitative survey may actually offer a stronger appraisal of their actual behaviors ... extent, in the broad Kornai-type framework A striking feature is indeed that, the probability of declaring profit appears graphically as a function of both real growth and financial discipline - ... quarters of the graph, though they are built to minimize intra-group variance, and maximize inter-group variance The main characters of each group are summed-up in Table 1, which reflects the average...
  • 30
  • 635
  • 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Ngày tải lên : 07/03/2014, 14:20
... was used for the protein [39] A significant speed-up of the calculations was achieved by calculating pKa values for only a subset of the titratable groups in the protein The subset of titratable ... [26,29] The pKa calculations indicate that Glu144 has a slightly elevated pKa in the free enzyme that, at least in part, results from the vicinity of Asp215 (Table 3, rows and 4) The calculations indicate ... indicate that the pKa of Glu144 is further, and somewhat drastically, increased upon substrate-binding The D142N mutant is interesting because it retains significant activity (suggesting that a wildtype-like...
  • 10
  • 651
  • 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Ngày tải lên : 17/03/2014, 17:20
... 600ỈM)1Ỉcm)1, and a ratio A2 74 /A4 55 % 8.7 All of the Y238 mutants of RgDAAO are competent in catalysis: the anaerobic addition of an excess of D-alanine (trace in Fig 2) resulted in instantaneous enzyme ... a main role of the side chain of this active site residue in substrate/ligand fixation The ligand-binding experiments demonstrate that the overall substrate-binding pocket remains intact, as all ... side chain in substrate/product exchange to the active site of RgDAAO A superimposition of the active sites of yeast and mammalian DAAO [2–4] shows that the side chain of Y223 of RgDAAO overlaps...
  • 10
  • 496
  • 0
Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary flux modes Stefan Schuster and Dimitar Kenanov ppt

Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary flux modes Stefan Schuster and Dimitar Kenanov ppt

Ngày tải lên : 30/03/2014, 20:20
... is involved in these pathways Since adenine is a substrate of ADPRT, the elevation of ATP in the absence of adenosine kinase shows that adenine must be released in the process before being incorporated ... mentioned in the Introduction that patients deficient in ADPRT are accumulating adenine [8–11] The modes of adenosine salvage (Table 3) all require AK, so that they are not operative in the case of AK ... predict that there is redundancy both in adenine salvage and in adenosine salvage in that parallel pathways producing ATP from each of these substrates exist While the metabolism of many cells...
  • 13
  • 476
  • 0
báo cáo hóa học: " Discrimination and reliability: equal partners? Understanding the role of discriminative instruments in HRQoL research: can Ferguson''''s Delta help? A response" pptx

báo cáo hóa học: " Discrimination and reliability: equal partners? Understanding the role of discriminative instruments in HRQoL research: can Ferguson''''s Delta help? A response" pptx

Ngày tải lên : 18/06/2014, 19:20
... to rank order people in a meaningful way This would invalidate any statistical treatment of data that failed to take measurement error into account It does not constitute an argument against the ... raise the interesting issue of what constitutes a meaningful discrimination, and whether Delta is an index of such discriminations This happens to be a valid point, but not as argued here Norman argues ... reliability for the task at hand; they should provide interpretable data; and thus any discriminations made should be 'real' My argument is that the degree to which a discriminative instrument actually...
  • 3
  • 384
  • 0
Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf

Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf

Ngày tải lên : 21/06/2014, 19:20
... stroke management [11] Relative MTT and absolute CBV are CT perfusion parameters that help define areas of infarct from areas of penumbra [6] Its use has also been investigated for the diagnosis of ... because of its decreased availability in contrast to the short acquisition time and wide availability for NCCT in the emergency room setting There are data supporting the use of CT perfusion in acute ... manuscript and assisted in CT perfusion image interpretation SE edited the manuscript as well as supervised All authors read and approved the final manuscript Authors’ information WG and HD are...
  • 4
  • 447
  • 0
Báo cáo y học: "Role of STAT4 polymorphisms in systemic lupus erythematosus in a Japanese population: a case-control association study of the STAT1-STAT4 region" pot

Báo cáo y học: "Role of STAT4 polymorphisms in systemic lupus erythematosus in a Japanese population: a case-control association study of the STAT1-STAT4 region" pot

Ngày tải lên : 09/08/2014, 13:22
... KH, MK, and TA participated in the first screening using Illumina GoldenGate assay (with AK), including tag SNP selection, genotyping, and statistical analysis JO carried out statistical analysis ... Area 'Applied Genomics' from the Ministry of Education, Culture, Sports, Science and Technology of Japan; and grants from the Ministry of Health, Labour and Welfare of Japan; the Japan Rheumatism ... Pivotal role of Stat4 and Stat6 in the pathogenesis of the lupus-like disease in the New Zealand mixed 2328 mice J Immunol 2003, 171:1564-1571 26 Akahoshi M, Nakashima H, Tanaka Y, Kohsaka T, Nagano...
  • 9
  • 478
  • 0
Báo cáo y học: "The challenge to verify ceramide’s role of apoptosis induction in human cardiomyocytes a pilot study" doc

Báo cáo y học: "The challenge to verify ceramide’s role of apoptosis induction in human cardiomyocytes a pilot study" doc

Ngày tải lên : 10/08/2014, 09:21
... translocation of the kinase to the plasma membrane and therefore inhibits its catalytic activity Finally the intrinsic and extrinsic pathways of apoptosis induction converge and lead to the activation of ... stained with antibodies against activated Caspase-3 (Epitomics, Inc.), also Caspases are a family of cytosolic aspartate-specific cysteine proteases involved in the initiation and execution of ... family of caspases is key mediator of apoptosis An extrinsic pathway involving cell surface death receptors [25] and an intrinsic pathway with intracellular and extracellular death signals which are...
  • 7
  • 513
  • 0
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx

Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx

Ngày tải lên : 11/08/2014, 03:20
... 5'-CAACACUCGCAAUAUU-3'(sense) 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) ... GGTGCTGTCAC-3', Anti sense: 5'- TGT Page of 12 GTAATTCTGCTCCTTCC -3'; β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG ... 3'-UUACACUACUUAUCCUCCACU5'(antisense) Cytoplasmic membrane domain 5'-UAGAGCUCUGAUAGAUCUCUU-3'(sense) 3'-UUAUCUCGAGACUAUCUAGAG5'(antisense) France, Illkirchcedex), was intravenously injected into...
  • 12
  • 287
  • 0
báo cáo khoa học: " Role of "external facilitation" in implementation of research findings: a qualitative evaluation of facilitation experiences in the Veterans Health Administration" potx

báo cáo khoa học: " Role of "external facilitation" in implementation of research findings: a qualitative evaluation of facilitation experiences in the Veterans Health Administration" potx

Ngày tải lên : 11/08/2014, 05:22
... networking But, facilitation can encompass those particular roles and be part of making these roles easier." Yet another said, "It really has a lot to with creating buy -in/ activating the sites/championing ... that a facilitator with face-to-face communication and using a "range of enabling techniques has some impact on changing clinical and organisational practice, although the effect size is variable ... Facilitation also may occur in variable forms, e.g., as a facilitator internal to an implementation site, an external facilitator [i.e., QUERI change agent], or a combination thereof In the latter instance,...
  • 15
  • 362
  • 0
Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx

Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx

Ngày tải lên : 11/08/2014, 11:20
... hypoxia and lactic acidosis can maintain all the described pathophysiologic mechanisms and induce a relative deficiency in vasopressin plasma concentration further amplifying the vasoplegic scenario ... available experiences [12], the above described pharmacological rationale and the choice of avoiding escalating therapy with alpha agonists This pharmacological approach allowed us to titrate the ... effects of administered catecholamines [6] Epinephrine has been widely accepted to be the standard medical therapy to reverse cardiovascular collapse in anaphylaxis Because of its α and β adrenergic...
  • 4
  • 370
  • 0
Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx

Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx

Ngày tải lên : 12/08/2014, 11:22
... International Classification of Functioning, Disability and Health and the position of the variables included in the study by Brionez and colleagues [1] AS, ankylosing spondylitis; BASFI, Bath Ankylosing ... psychological variables and biomedical factors would help improve our understanding of, and insight into, health outcomes Identification of a core set of psychological variables from the increasingly large ... earlier and powerful treatments, a diagnosis (a stressful event!) may impact the patient in terms of mental and behavioral beliefs, and will probably in uence the experience of health Existing...
  • 3
  • 256
  • 0
A STUDY ON THE ROLE OF USING VIETNAMESE IN TEACHING ENGLISH VOCABULARY TO THE 10TH FORM ETHNIC MINORITY STUDENTS AT VUNG CAO VIET BAC HIGH SCHOOL -Nghiên cứu về vai trò của việc sử dụng Tiếng Việt trong dạy từ vựng Tiếng Anh cho học sinh dân

A STUDY ON THE ROLE OF USING VIETNAMESE IN TEACHING ENGLISH VOCABULARY TO THE 10TH FORM ETHNIC MINORITY STUDENTS AT VUNG CAO VIET BAC HIGH SCHOOL -Nghiên cứu về vai trò của việc sử dụng Tiếng Việt trong dạy từ vựng Tiếng Anh cho học sinh dân

Ngày tải lên : 30/03/2015, 14:00
... target language and to have an acceptable pronunciation The Reading approach attracted more importance than grammatical skill The vocabulary used in the reading passages is controlled at beginning ... proficient in the second languageThe first language can help to move the task along by establishing a joint understanding of the text and to manage the task  The first language allows learners ... Translation Method towards second language learning and vocabulary teaching and learning in particular It also covers the influence of the first language to the second language acquisition There...
  • 60
  • 777
  • 0
The feasibility of integrated approach in English language teaching at Maritime College No.1, Haiphong = Tính khả thi của phương pháp tích hợp trong giản.PDF

The feasibility of integrated approach in English language teaching at Maritime College No.1, Haiphong = Tính khả thi của phương pháp tích hợp trong giản.PDF

Ngày tải lên : 30/03/2015, 14:32
... are the advantages and disadvantages of using integrated approach at Maritime College No.1, Hai Phong? 2.1.2 The participants The study investigates the feasibility of applying integrated approach ... is a combination of four language skills including Listening, Speaking, Writing and Reading is the most important task for teachers 1.2.3 The advantages of integrated approach To summarize, using ... 1, two significant trends on teachers' ideas on the advantages of integrated approach can bring about in the belief of teachers Table 1: Advantages of Integrated Approach No Advantages (%) Help...
  • 16
  • 567
  • 0