the role of enzymology in a structure based drug discovery program bacterial dna gyrase
TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx
... Pain Polarizing discussions during the past 10 years have made the role of the dentist in diagnosing and treating pain in the head and neck region increasingly obscure rather than more clear In ... neuralgia Herpes zoster Peripheral neuritis Neurovascular pain Vascular pain Episodic pain Paroxysmal neuralgia Glandular, ocular, and auricular pain Pulpaf pain Viscera! pain Visceral mucosal pain ... Cluster headache Paroxysmal unilateral headache Neurovascular variants Arteritis pain Carotidynia joint surface pain Retrodiscal palm Capsule pain Ligament pain Arthritic pmn Myofascial pain Myositis...
- 379
- 1,162
- 0
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf
... The main emphasis was put on strengthening research and highquality education The Commission proposed a standardisation and streamlining of teaching programmes, a large increase in doctoral programmes, ... innovation are increasingly being framed within an international arena The links between sub-regional, regional, national and international systems of innovations imply hat analyses should include ... strengthen the technical learning ability of the economy in a period of radical technical change They concluded that the capability of national economies to learn abou, adapt and change their instiutional...
- 180
- 596
- 1
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
... study of 3260 enrollees in a national managed care organization in the United States, that 23% of the English-speaking and 34% of the Spanish-speaking respondents could not adequately read and ... than words alone However, words are still important in explaining the implications of the pictures and in explaining what is happening in the pictures This hypothesis includes the same qualification ... Koplan JP Health literacy among medicare enrollees in a managed care organization JAMA 1999; 281:545–51 [10] International Reading Association, Special Interest group on reading and readability...
- 18
- 919
- 0
báo cáo hóa học:"The role of disclosure in relation to assent to participate in HIV-related research among HIV-infected youth: a formative study" docx
... Ethical approvals The formative research was approved by the Institutional Review Boards at the Kinshasa School of Public Health in the DRC and at the University of North Carolina at Chapel Hill in ... should be a component of the research, being mindful that the minors participating in the research may in fact want to know that they have HIV Participation in the research could serve as a first ... be told at the beginning of the research Their reasons focused on reducing the children being taken aback upon learning their status during the course of the research and for enhancing the children's...
- 10
- 372
- 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGAATCCCCGCAGACCATGACAC fwd ACGTTGGATGAGTCGGTAGCAACACCAGG ... ACGTTGGATGTTGCTCAGCCCCAAAGATGG fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCC rev ACGTTGGATGTATGGTTCGACTGAGTCCAC ACTCGAGGCCTGTGAATTCC 93.73 GCCGGCTCCCAAGCTCC 92.03 CCTGCTGGCCATGCTCCTCAGC 92.99 GCTGCCTCTGCTCCCAGG...
- 12
- 355
- 0
Báo cáo y học: " The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model" pot
... preparation and toxin quantification RV participated in animal experimentation AA was involved in histopathological studies and image analysis FV participated in coordination of experiments and manuscript ... BAL are related to the bacterial burden The significant decrease in number of bacteria after 12 h of infection is probably due to the host response, and was also observed in another intranasal ... in alveolar macrophages has been associated with bacterial internalization [40], programmed cell death directly induced by PLY has been described in alveolar macrophages and nasopharyngeal epithelium...
- 10
- 350
- 0
Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx
... by inhalation of Gramnegative bacteria, simultaneous intravenous administration of recombinant human antithrombin caused histologic damage, injury to the alveolar capillary barrier and increased ... that if administration of heparin concomitantly with antithrombin is withheld, then the antiinflammatory potential of the latter can be improved Disseminated intravascular coagulation and antithrombin-dependent ... Both of these inhibit serine proteases and cofactors/activated coagulation factors [1] Antithrombin is a 58 kDa glycoprotein that is composed of a single amino acid chain with a plasma concentration...
- 9
- 393
- 0
Báo cáo y học: " The role of recombination in the emergence of a complex and dynamic HIV epidemic" pptx
... to have migrated to Xinjiang along a northern drug trafficking route [26,28] CRF08 is a predominant subtype among intravenous drug users (IDUs) in Guangxi and the east part of the Yunnan province ... from India, but not Africa as India has (Additional file 1, Fig S2B) Finally, the dominant South American C epidemic appears to have derived from a single introduction from Africa ([45,46] and Additional ... cover a full HIV-1 genome of each subtype, meaning that there was a potential to form any BF recombinants in Argentina and that there was no need to assume that already-recombined genomes came...
- 15
- 259
- 0
Báo cáo y học: " Updating the evidence for the role of corticosteroids in severe sepsis and septic shock: a Bayesian meta-analytic perspective" pot
... the variability in intra-trial reporting, this was not feasible As the hazard ratio may be approximated from the OR [23], we chose the OR as an appropriate metric [24] Bayesian parameter estimates, ... Central Register of Controlled trials, Cochrane database of systematic reviews, American College of Physicians Journal Club, Health Technology Assessment Database and Database of Abstracts of Reviews ... colleagues Annane and Table Trial patient data by outcome (Continued) #, mortality statistics for Chawla and colleagues [47] were abstracted from the Annane and colleagues meta-analysis[6] ##, data...
- 15
- 536
- 0
the role of uncertainty in transaction cost and resource-based theories of the firm
... hierarchical governance rather than market governance On the other hand, another kind of causal ambiguity, causal ambiguity within the firm, explains why firms may avoid hierarchical governance in ... resources and capabilities that the individual cannot create or obtain through the market because the resources and capabilities are causally ambiguous, the individual may have to make a firm to get access ... ‘causal ambiguity within the firm’ as a type of uncertainty in the context of resourcebased theory When a target firm has causally ambiguous resources and capabilities that ii a bidding firm cannot...
- 153
- 286
- 0
UNDERSTANDING AND MINIMIZING THE ROLE OF DEFECTS IN SELF ASSEMBLED MONOLAYER BASED JUNCTIONS
... List of Symbols Aelec Electrical contact area Agb Area of grain boundaries Ageo Geometrical contact area Agr Grain size BV Bearing volume CSAM SAM capacitance d Thickness of the SAMs dgb Grain ... complicate the interpretation of the data that generated in physical-organic studies of charge transport All of these methods have their own advantages and -1- disadvantages and contain defects inherent ... temperature dependent measurement of Fc based SAMs in EGaIn array devices The current density changed as a function of temperature indicated a thermal active charge transport mechanism in the Fc based...
- 318
- 324
- 0
A transmembrane mutation in FcgRIIb reveals the role of ceramide in phagocytosis and autoimmunity
... crystalline state as they contain saturated and unsaturated acyl chains of variable length in which the acyl chains are fluid and disordered In the absence of other lipids, membranes containing ... 1.8) The lipid moiety can vary in terms of chain length of the fatty acids and in the degree of saturation and hydroxylation of the sphingoid base Also, variations in the type, number and linkage ... particle The receptor-ligand interaction activates signal transduction pathways that result in the internalization of the target particle The internalized particle is contained in a plasma membrane...
- 260
- 334
- 0
A study of the role of guanxi in sino japanese distribution channel relationships in china
... of the Sino-Japanese relation in regards to politics, the economy, and cultural communication 2.4.1 Japan in China’s Media To examine the propaganda about Japan in China’s media, an investigation ... China and Japan has developed actively since the 1980s In particular, Japan’s investment has increased dramatically Entering the Chinese market has become a popular issue among Japanese businessmen ... in china serving as a social key towards achieving various goals There is a large body of literature evaluating the nature and role of guanxi in Chinese society The importance of guanxi relationship...
- 132
- 289
- 0
The role of serum amyloid a in atherosclerosis
... minimization of tissue damage and promotion of healing (Baranova et al., 2010; Sandri et al., 2008) In the event of a tissue injury, the acute phase response initiates the activation of a cascade, ... Receptor Interacting Protein (RIP1) instead of with Fas associated death domain (FADD) and caspase would activate the NFκB survival mechanism (Oeckinghaus et al., 2011) As the absence of TRAF2 would ... SAA-LDL complex have also been reported (Kotani et al., 2009; Ogasawara et al., 2004) At elevated level, SAA is able to replace apoA-I in HDL, taking over as the predominant apolipoprotein of...
- 172
- 352
- 0
Circuit theory of finance and the role of incentives in financial sector reform
... further assess the riskiness of the bank Finally, the inadequacy of the static accounting framework, underpinning the capital ratios approach, in tracing the dynamics of the bank’ trading strategy; ... is offered in India by the non-banking financial companies sector (Pahwa, 1998) Another important advantage of any informal-formal link is that formal financial institutions would have an incentive ... capital of others, and that sound financial infrastructures that strengthen 21 trust and prudence increase the return to all participants Thus, producing and maintaining financial infrastructures...
- 55
- 665
- 0
Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient
... colorectal carcinoma [33] There was also a focal expression of MUC6 in the colonic epithelium in the teratoma (Table 1), a finding we have also made in a study on colorectal carcinoma [34] The tissue ... feature of various cancers including cancer of the colon [33] The amino acid analysis of the purified mucin gave high amounts of ‘mucin-like amino acids, serine, threonine and proline Serine and ... acid analysis of purified mucin from a mature ovarian cyst teratoma Amino acid Aspartic acid (D) Threonine (T) Serine (S) Glutamic acid (E) Proline (P) Glycine (G) Alanine (A) Cysteine (C) Valine...
- 9
- 549
- 0
The role of language in adult education and poverty reduction in Botswan
... the other languages that exist in the country, the adult language program in Botswana maintains the hegemony and the gap between the poor and the rich, the major and minority groups In order to ... practice in Botswana is that illiterates in the adult education program are taught in Setswana even in environments where it is not the native language Setswana is not the native language for at least ... the teaching of local languages, Setswana and English By involving the local languages the program would not only reach the poor and marginalized communities but it would also instill the qualities...
- 5
- 836
- 1
The role of advertising in society
... need of more In the absence of the massive and artful persuasion that accompanies the management of demand, increasing abundance might well have reduced the interest of people in acquiring more ... vital tools in Marketing The appearance and the role of advertising is increasingly higher in the market economy Advertising shows the rapid growth in technology and lifestyle, in people’s tastes ... in a marketing program will vary depending on the situation facing the organization and what information needs to be communicated Part II : the role of advertising in society Economic effects of...
- 27
- 1,115
- 1
Tài liệu Determining the Length of Columns in a SQL Server Table doc
... // Add table mappings da.TableMappings.Add("Table", "Orders"); da.TableMappings.Add("Table1", "Order Details"); // Create the DataSet DataSet ds = new DataSet( ); // Fill the schema and data da.FillSchema(ds, ... Microsoft SQL Server Books Online The GetSchemaTable( ) method of the DataReader also returns all column lengths The method returns a DataTable containing column metadata for a DataReader, where the ... name The code then iterates over the collection of columns in the table and displays the length, precision, and scale for each from the Hashtable Information from the FillSchema( ) method of the...
- 4
- 458
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25