... because the Standard window reduces the bias but at the same time increases the variance On the other hand, the use of the Rectangular window makes a FTE biased even forhigh SNR In Fig 21 the behavior ... match the natural period of the signal, discontinuities appear at the boundaries of the record These discontinuities [16 ] are the cause of the leakage The function of a window is to reduce them For ... desired and the reduction of the side lobes In any case, the spectral resolution, in Hz, is limited [15, pp 46 – 49 ] to the reciprocal of the observation time, ( NDt ) 01 Therefore, frequency...
... AFM Here, in the contrast curves, D0 and D100 are the intersections of the line having the highest slope with the zero and full resist thickness lines, respectively The contrast for exposure ... agreement with the fact that sensitivity is roughly inversely proportional to the beam energy (E) as predicted by the Bethe equation for electron energy loss (E loss ) in the resist: Eloss ∞ 1/E ... generally used forhighresolution patterning in to reduce the effect of capillary force during resist drying, which leads to pattern collapse (unless using critical point drying [12]), and the forward...
... CNt The form of quantization in (2) minimizes the angle between the normalized channel vector hu / hu and the entries of the codebook Under the zero-forcing criterion, the transmit beamforming ... no vector is parallel to the root vector This is to ensure no redundancy and only a single root vector in the codebook Property ensures there are no orthogonal vectors to the root vector The reason ... codebook is bits forthe base quantization, bits forthe first refinement, bits forthe second refinement, and bits forthe final refinement We compare with random vector quantization with the corresponding...
... fraction thereof AFM provides the advantage of directly observing spermatozoa in their native environment thereby opening the exciting possibility of analyzing their structural and functional aspects ... Figure shows the 2D and 3D images of the normal human spermatozoa using non-contact mode AFM; the graph indicates the head and the length profiles of the head region Defects in the acrosomal ... provide high- resolution 3D images owing to the small size of the spermatozoa Optical microscopy provides valuable information only if the alterations are gross and of the order of a micron or fraction...
... disease HRCT was performed with 1- to 2-mm collimation sections reconstructed by the use of a high spatial frequency algorithm using a (General Electric Medical Systems, Milwaukee, WI) The HRCT protocol ... of the patients had persistently high HRCT scores (Table 1) One with very high HRCT score at 60 days refused a follow-up HRCT Factors associated with residual HRCT abnormalities at day 60 The ... and blood cultures were performed on all the cases to exclude bacterial or fungal infections At 90 days, all the close contact relatives of the study SARS patients had their serum anti-coronavirus...
... • Đại cương: • HR CT cũa phổi kỹ thuật sử dụng rộng rãi có giá trò lớn • Nó dùng XQ v LS nghi ngờ bênh phổi lan toả • Kỹ thuật: • HRCT gồm lát cắt mỏng 1-1,5mm (CT quy ước 8-10mm) • Thường ... IPF - Typical Peripheral Disease Pattern On HRCT Aug 27, 2014 34 Basic HRCT Patterns LAM Aug 27, 2014 35 of Histiocytosis X, Aug 27, 2014 36 Di theo bạch huyết -Sự lan tràn mô ác tính mô kẽ(bó ... tính,lao,nấm,sarcoid Vôi hoá;Nhiễm bụi Aug 27, 2014 13 Mô kẽ -Mô kẽ bình thường HRCT không thấy được, bệnh lý biểu rõ HRCT -Những ngăn mô kẽ phổi +Quanh bó PQ-mạch máu +Trung tâm tiểu thuỳ(Đoạn xa...
... model forthe variation of the autocorrelation matrix eigenvalues The function g1 (k) can be therefore expressed as g1 (k) = completely white The more colored is the noise, the larger is the dynamic ... (a) the discriminant functions and (b) the associated cost function, for N = estimate, the eigenvalue variation can be still used, in a different form, for obtaining N The main idea behind the ... integrate the irregular eigenvalue variation A smoother form of the second discriminant function can be thus obtained The shapes of the two discriminant functions calculated with (8) and (9), for the...
... elegans, the number of blocks detected was not signifi- cantly higher than expected by chance for either comparison (P = 0.68 and P = 0.39, respectively) In contrast, the other three metazoan genomes ... via highresolution melting analysis Mapping population Among the methods available for high- throughput SNP genotyping, the simple, fast and cost-effective HRM method is especially suitable for ... level in L8 of the male parent may reflect strong haploid selection (for example, one of the homologous chromosomes corresponding to L8 might produce functional sperm, while the other might contain...
... 313 V tttgggtatgcctccgt tggaggcgcttcataatact 163 VI SBEIIa-A ttgctctaaatttatgatctggct aggtggaagattgccaag 153 VII tgctcctattgatgccgat gctacatgctcaactaaataattgg 152 VIII ctctgcccactaagggt aaatttcatttaataatgtaatggagatcg ... VIII cctattgatgccgatatttgatatg aactctgcctactaagggt tcctcgactaaataattggccag acactggaaattccatttaataatgtaac 152 204 IX ccttttgtgaccatttactaaggata ccggaaacaggtgaaataact 157 II actattgtagtcatccttgcatt ... catagcaattatttcagtgccct aacacactgctaaatttgaatgat agactagtggaggcgtt 19 V SBEIIa-B tgttaaatctgttcttacacatgtcg IV tgctgaaggtatcatctaattgc tgaccattaacaatagattagaaggtg 159 VI cagttactctaaatttatgatctggct aggtggaagattgccaag...
... perfectly suited forthe production of the reanalysis The setup in ecflow follows in general the above depicted structure of the RPS, the technical details of the implementation are nevertheless ... COSMO-REA6 The overall vision of the project was to create a high- resolution reanalysis for Europe and an even higher resolved one for Germany, following the setup of the Numerical Weather Prediction ... is performed, followed by another Snow Analysis The SMA is performed last, in the way as explained in section 2.1.7.4 The updated fields from these three separate procedures then 31 A high- resolution...
... sible forthe restricted pharmacological effects of chemotherapeutic agents, the local concentration is sufficient to overcome the intractability for cell killing under protection non-affected ... 145 cells in the G1 phase allows the DNA-repair and subsequently the re-entry in the cell cycle Therefore these cells turn out to be refractory against TMZ as shown in the TMZ-based therapy of ... represented In the upper line the corresponding module in the single code mode is represented Table Middle and right part of the table represents the dienophile-educt forthe DARinv: K(TcT)-NLS-S∩S-CPP...
... Preparation for Practice: What does the teacher in order to focus the students' attention forthe next activity? Further practice: What other activities does the teacher to give the students ... CHECK Stop the activity and choose a random pair Ask them to repeat the activity Do the same with two other pairs If the students know the teacher is going to check after the activity, they will ... • Information gap The principle that two or more students engaged in a practice activity not share exactly the same information If the task is correctly set, the students must pool their information...
... NATIONAL UNIVERSITY, HANOI COLLEGE OF FOREIGN LANGUAGES POST GRADUATE STUDIES DEPARTMENT TRẦN QUỐC VIỆT A STUDY ON THE TECHNIQUES FORTHE IMPROVEMENT TO THE TEACHING OF ORAL SKILLS IN LIGHT OF ... COMMUNICATIVE ENGLISH LANGUAGE TEACHING FOR JUNIOR HIGH SCHOOL TEACHERS IN QUẢNG NGÃI PROVINCE (NGHIÊN CỨU CÁC THỦ THUẬT NÂNG CAO VIỆC DẠY KỸ NĂNG NGHE NÓI TIẾNG ANH THEO ĐƯỜNG HƯỚNG GIAO TIẾP CHO GIÁO ... NÓI TIẾNG ANH THEO ĐƯỜNG HƯỚNG GIAO TIẾP CHO GIÁO VIÊN TRUNG HỌC CƠ SỞ TẠI TỈNH QUẢNG NGÃI) M.A.THESIS HA NOI-2007 ...
... College of Foreign Languages, Vietnam National University-Hanoi for their valuable lectures And their knowledge, their thoughtfulness as well as their sympathy I will always appreciate Forthe accomplishment ... Techniques to Improve the Teaching of Oral Skills for Junior High School Teachers in Quang Ngai Province 14 3.1 Techniques for teaching speaking 14 3.1.1 Introduction ... guidance and correction I would like to acknowledge my debt to Assoc Prof Dr Lê Hùng Tiến and the staff members of Postgraduate Department, College of Foreign Languages, VNU-Hanoi for their enthusiastic...
... now almost forgotten For industrial products, the case of electronics is characteristic: In the 1950s the input medium for information processing was first performed by vacuum tubes These vacuum ... definition for high- tech products In any case, technology is not the only characteristic and discriminating feature of these products When asked about the main characteristics of high- tech products, ... products that then progress through their own life cycles with the same phases (introduction, growth, maturity, and decline) The product life cycle is the mirror image of the changing needs that the...
... morning activities The pictures in the textbook on page 16 describe his activities Listen to the tape, and then number the pictures in the correct order By asking students to look at the pictures ... hear the text at least three times The first time, the teacher reads the text aloud at rather high speed, students listen only and get the general idea of the listening text The second time, the ... time, the teacher can read the whole text through again This helps students correct their dictation 33 themselves After the dictation, the teacher should check students’ work and encourage them...
... frighted thee? II Uses of the Objective 59 .The objective case is used as follows:— (1) As the direct object of a verb, naming the person or thing directly receiving the action of the verb: "Woodman, ... tree!" (2) As the indirect object of a verb, naming the person or thing indirectly affected by the action of the verb: "Give the devil his due." (3) Adverbially, defining the action of a verb ... said before (Sec 56), there are only two case forms One is the simple form of a word, expressing the relations of nominative and objective; the other is formed by adding 's to the simple form,...
... the metal ion by the nitrogens of the imidazole rings of the histidines and the amino group in the N-terminus Use of the signal intensity reduction of the 1H–13C HSQC crosspeaks to estimate the ... second binding site for zinc is suggested by the selective effect for some residues in the C-terminal region The general signal intensity reduction in the 1H–15N HSQC spectra due to zinc binding ... path-length quartz cell was used, and the spectral range was 190–250 nm Theresolution was 0.2 nm, and the bandwidth was nm The background was corrected for in all spectra The CD signal, in mdeg, was converted...
... directly in our models for these factors Forthe ageing-related burden, we account indirectly by using the variable old dependency ratio as an explanatory factor forthe private saving rate; the ... instrument the debt variable for each country through either its time lags (up to the 5th lag) or through the average of the debt levels of the other countries in the sample Both instruments are highly ... closed-economy form Given the relatively small dimension of the country cross section and the need to control for country specific characteristics, the equation also contains country-fixed effects The country...
... or other direct interactions with the flavin However, the wide spread in predicted pI values for NrdI sequences is unexpected The data point to the interesting possibility of two distinct functional ... on the structural effects on the flavin of photoreduction during data collection Given the functional disparities between NrdI and normal Flds, it is important to study the structural basis for ... structures, and thehighresolution of the oxidized form allows confirmation of the protonation Results The crystal structure of baNrdI has been solved to ˚ 0.96 A resolution with the FMN cofactor in...