the quantitative determination of methyl paraben in a prepared sample by hplc
báo cáo hóa học: " Psychometric evaluation of the SF-36 (v.2) questionnaire in a probability sample of Brazilian households: results of the survey Pesquisa Dimensões Sociais das Desigualdades (PDSD), Brazil, 2008" docx
... groups The relative validity estimated for each scale was calculated as the ratio of the largest F-value obtained among scales to the F-value of the scale Data from the heads of Page of 10 households ... CMT, ALN, LAA and MMV drafted the questionnaires and contributed in the analysis and interpretation of the data All authors read and approved the final manuscript Competing interests The authors ... protection of human subjects from research risks and consent of research subjects and informants was obtained in advance as mandated by the Code of Ethics of the International Sociological Association...
- 10
- 569
- 0
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt
... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol ... functional equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, no 4, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach ... Ulam,” Journal of Approximation Theory, vol 57, no 3, pp 268–273, 1989 T M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical Society,...
- 15
- 362
- 0
Báo cáo lâm nghiệp: " Quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Udaipur, Indi" pdf
... similar to that found by Chaturvedi and Singh (1987) in a pine forest, Rawat and Singh (1988) in an oak forest and by Bargali et al (1992), in a Eucalyptus plantation, in Central Himalaya, India Acknowledgements ... aboveground biomass of teak plantation, Udaipur, Rajasthan, India N Component Table Concentration of nutrients (% ± 1.s.e.) in the aboveground biomass of teak plantation, Udaipur, Rajasthan, India 1.79 ... however, there is a lack of knowledge concerning the quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Rajasthan, western India Therefore,...
- 6
- 353
- 0
Báo cáo y học: "Variations in branching of the posterior cord of brachial plexus in a Kenyan population" ppsx
... conception and design of the study, data collection and analysis, drafting of the manuscript ML was involved in conception and design of the study, data collection and analysis, drafting of the manuscript ... 13.3% Page of population differences in anatomy of the brachial plexus This variant anatomy is important in explaining the outcome of attempted subscapular block in hemiplegic patients with painful ... cadavers This rare variation may be caused by the segmental origin of the axillary artery and its branching which may determine the arrangement of the brachial plexus during fetal development...
- 5
- 243
- 0
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx
... 5'-CAACACUCGCAAUAUU-3'(sense) 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) ... GGTGCTGTCAC-3', Anti sense: 5'- TGT Page of 12 GTAATTCTGCTCCTTCC -3'; β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG ... 3'-UUACACUACUUAUCCUCCACU5'(antisense) Cytoplasmic membrane domain 5'-UAGAGCUCUGAUAGAUCUCUU-3'(sense) 3'-UUAUCUCGAGACUAUCUAGAG5'(antisense) France, Illkirchcedex), was intravenously injected into...
- 12
- 287
- 0
Báo cáo khoa học: " Ruminal acidosis and the rapid onset of ruminal parakeratosis in a mature dairy cow: a case report" doc
... Acta Veterinaria Scandinavica 2009, 51:39 condition of ruminal parakeratosis The characteristics of ruminal parakeratosis include accumulated layers of keratinized, nucleated squamous epithelial ... not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:39 ventral sac of the rumen via the cannula immediately after the final day of the HF and HG treatments Rumen papillae biopsies ... during the HF and HG diets are summarized in Figure The HF diet resulted in a mean ruminal pH of 6.58 ± 0.02 with a daily minimum of 6.42 and a maximum of 6.85 In contrast, the average ruminal...
- 6
- 333
- 0
Approximation to the stationary distribution of information flows in a communication network
... Gibbs sampler (a type of the naive Gibbs sampler) It was essentially a random sampler, which updated the sample in each cycle with an acceptance probability, as that of the MCMC sampler 2.4 Chapter ... such as the PANACEA is that it requires only renewal arrivals rather than Poisson arrivals as in the other solvers, thus the modelling error is largely eliminated The drawback is that it assumes ... allocation The Max-min and Kelly’s proportional fairness allocations are then the special cases of the α allocation rule These fairness bandwidth allocation rules are critical to another important aspect...
- 98
- 418
- 0
The changing role of managerial accounting in a dynamic business environment
... Financial Accounting Accounting Accounting System System (accumulates (accumulates financial financial and and managerial managerial accounting accounting data data in in the the cost cost accounting ... making making and and planning planning •• Assisting Assisting managers managers in in directing directing and and controlling controlling activities activities •• Motivating Motivating managers ... Supervising Supervising accounting accounting personnel personnel –– Preparation Preparation of of information information and and reports, reports, managerial managerial and and financial financial...
- 31
- 433
- 0
Báo cáo y học: "Secondary prevention of allergic symptoms in a dairy farmer by use of a milking robot" ppsx
... German Professionals insurance laws require a complete elimination of allergens for the recognition of an allergic airway disease as a compensable occupational disease Complete avoidance of occupational ... bronchial hyperresponsiveness was verified by a positive histamine inhalation challenge test The diagnosis of occupational asthma was confirmed by a separate specific inhalation challenge test using ... robot in 1999, i.e., an automatic milking system (AMS) At present circa 1300 AMS are installed, predominantly in the Netherlands, followed by Germany AMS were developed in the course of increasing...
- 4
- 279
- 0
Improving the audit process of fixed assets in financial audits conducted by VACO auditing company limited
... collecting the relevant evidence as a basis data to present in the financial statements Test of detail in the increase or decrease transactions of the business Checking in detailed the increase ... with the Managing Board, review the internal report after the date of the financial statements, review of the book is made after the date of the financial statements, check the records released after ... original costs, depreciation and amortization rates for comparison to analyze increase or decrease in the balance tangible or intangible fixed asset, and auditors can compare the data with data in...
- 89
- 525
- 6
Improving the audit process of fixed assets in financial audits conducted by ac auditing and consulting company limited
... analyze increase or decrease in the balance tangible or intangible fixed asset, and auditors can compare the data with data in last year to evaluate the reasonableness of the volatility Auditors ... following procedure: - Interview with the Managing Board - Review the internal report after the date of the financial statements - Review of the book is made after the date of the financial statements ... Sequence in auditing fixed assets in financial audits at A Company conducted by A& C Auditing and Consulting Company Limited 2.2.1 Audit planning 2.2.1.1 Innial audit planning A is a traditional client...
- 86
- 783
- 12
Determination of Operation Factors in Treating Piggery Wastewater by Membrane Bioreactor
... years ago and main applied in the treatment of domestic sewage, industrial wastewater and hospital wastewater [5] Research publications in the MBR applying for piggery wastewater treatment are ... constant permeate flux 12 L/m2.h - Piggery wastewater was collected from a pig farming households (Thuong Tin, Hanoi) The wastewater was taken at the discharged drainage of breading facilities The ... constant permeate flux 12 L/m2.h - Piggery wastewater was collected from a pig farming households (Thuong Tin, Hanoi) The wastewater was taken at the discharged drainage of breading facilities The...
- 14
- 210
- 0
Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx
... were taken The principal provenance trial, established Krahl-Urban in 1950, was located in the Bramwald Forest In 1951, the trial was replicated at Syke near Bremen, using seedling transplants ... it can be seen that the factors significantly influencing vessel size are the width of annual rings and provenances There is also an interaction of provenance with sites which reinforces Kleinschmit’s ... similar material in oaks (Nepveu, 1984) These results are discussed in more detail by Kanowski σ2 &2;are the components due eg and sigma The analysis of variance, summarized in table III,...
- 4
- 287
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using known amounts of the Ca 2+ standard included ... present in the ovary, whereas the remaining ovules showed no labelling This localization pattern was observed in more than 80% of the ovaries at stage and in more than 95% of the ovaries at stage ... precipitates in the vacuoles of the stigma cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange between pollen and stigma Ca2+ ions are...
- 12
- 529
- 0
DETERMINATION OF THE APPROPRIATE CONTENT OF CALCIUM NITRITE AS A CORROSION INHIBITOR IN REINFORCED CONCRETE docx
... extract containing (CN and 6,0 kg Cl-) Research results Effectiveness of corrosion inhibition in extract of cement water containing Cl-: • In H0 extract, steel is maintained in passive state and ... very fast under the effect of chloride ion in marine environment Cua Cam port The strongly agressivity rate of chloride ion is the main reason causing corrosion, especially in the tropical climate ... research methodology Testing samples 1.Extract of cement water Reinforced concrete samples Material and research methodology Extract of cement water Reference extract of cement water (H0) Extract...
- 26
- 274
- 0
A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents
... features and making a contrastive analysis to find out the similarities and differences between the syntactic features of ESVs and VSVs - Analyzing data of ESVs and VSVs in terms of the semantic features ... consist of 300 samples of ESVs and VSVs: 219 samples in magazines and 58 samples, 10 samples and 23 samples in short stories, dictionaries and the internet respectively Lastly, the distinctive features ... 22 Table 4.46 A Summary of the Meaning Nuances of SUGGEST Table 4.48 A Summary of the Comparison of the Meaning and Their Vietnamese Equivalents Verb English Meaning Nuances Vietnamese Equivalents...
- 13
- 1,330
- 5
Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc
... from the boundary Here small means contained in a small ball 527 PLANAR DOMAINS A “pair of pants” (in bold) Graphical annuli (dotted) separate the “pairs of pants” Figure 4: Decomposing the Riemann ... single-valued over a domain in the plane (as is the case in Theorem 0.3) Combining Theorem 0.3 with the solution of a Plateau problem of MeeksYau (proven initially for convex domains in Theorem of ... how the multi-valued graphs fit together and, in particular, prove regularity of the set of points of large curvature – the axis of the double spiral staircase To describe general planar domains...
- 51
- 463
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25