the properties of each object are listed in a properties category here the bordercolor property of a textfield object is selected
Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx
Ngày tải lên :
21/02/2014, 00:20
... building and mutational analysis Protein Eng 4, 891–901 Ogata, K., Morikawa, S., Nakamura, H., Sekikawa, A. , Inoue, T., Kanai, H., Sarai, A. , Ishii, S & Nishimura, Y (1994) Solution structure of a ... 6) This experiment also showed that there is an accumulation of sumoylated Myb in the insoluble fraction of the nucleus, indicating that sumoylation stabilizes the association of c-Myb with insoluble ... Ichikawa-Iwata, E., Sasaki, M., InoueBungo, T., Shiina, M., Kimura, K., Takata, S., Fujikawa, A. , Morii, H., Kumasaka, T., Yamamoto, M., Ishii, S & Ogata, K (2002) Mechanism of c-Myb-C/EBP beta cooperation...
- 11
- 556
- 0
Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?
Ngày tải lên :
26/12/2014, 08:36
... learn and develop further 5)wise in the handling of document • A good manager must know how in the processing data Maybe managers are afraid of cumbersome paperwork but the manager also very intoxicated ... Cor, meaning heart It means to give courage, confidence or hope Having courage is having the ability to disregard fear and to be brave The easiest way to be brave and fearless is to listen to and ... an environment where new ideas can flow and flourish, follow some of these basic leadership and management practices 7)Information processing and thinking capacity • The power of your brain is...
- 16
- 1.4K
- 1
Báo cáo sinh học: "Second chromosome polymorphism of Drosophila buzzatii in a natural population is not associated with gametic selection and does not affect mating pattern" potx
Ngày tải lên :
14/08/2014, 20:20
... obtained by Ruiz et al (1991) in a Spanish natural population of D buzzatii However, our analysis is based on the assumption that the offspring of each wild inseminated female was fathered by a ... were maintained until pupation in order to estimate larval viability by counting all pupae Further collections were performed in A Escobar in March 1989 by means of banana baits and with Opuntia ... were: standard 0.315 The observed and random mating expected numbers of each mating class are shown in table I Since the frequencies of certain mating classes were extremely low, goodness of fit...
- 16
- 198
- 0
Corporate social responsibility and firm performance in a developing nation is there any linkage
Ngày tải lên :
04/10/2015, 08:00
... Panel Data Analysis For the econometric analysis of the data, I used a longitudinal panel data analysis In total I had 648 observations after taking care of the missing data 28 The companies in my ... experience as a control variable This variable was measured by the number of years the firm was in operation at the beginning of each accounting period A log value of number of years in operation was ... exposure and years of international expertise But our companies are learning and they are also engaging in such activities, sometimes at a grand scale, as have been displayed by the banking industry...
- 38
- 346
- 0
The following is a list of colours. A number of the color swatches below are taken from domainspecific naming schemes such as X11 or HTML4. RGB values are given for each swatch because such standards are defined in terms of the sRGB color space. It is not
Ngày tải lên :
02/06/2015, 23:04
... rectangle heart triangle star square circle ...
- 3
- 529
- 0
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf
Ngày tải lên :
12/02/2014, 19:20
... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item in that sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At ... than the domains of the CHIPCE when evaluating ADHD patients This is supported by the factor analysis based on the sub-domains and the correlation analysis of the sub-domains, which showed that ... this analysis Inclusion of patients receiving active treatment and placebo in the analysis over time will increase the range of the changes and will thus lead to a wider basis for the evaluation...
- 15
- 1.2K
- 0
Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc
Ngày tải lên :
05/03/2014, 23:20
... component of the domain B Then the ratio |Akl +1 | |Akl | tends to exponentially fast, where |Ak | is the length of the real trace of the domain Ak Here the real trace of the domain is just the intersection ... renormalizable and ˜ the interval T is called a restrictive interval If there are in nitely many intervals such that the first return map of f to any of these intervals is unimodal, then the map f is called ... is not an Axiom A map We want to the same with an arbitrary unimodal map of an interval So the first reasonable question one may ask is “What makes quadratic maps so special”? Here is a list of...
- 44
- 412
- 0
BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx
Ngày tải lên :
09/03/2014, 00:20
... “How can we reduce the amount of garbage?” are often asked The expression “minimizing waste” is governing many trends, in each phase of the chain Customers, who are becoming more and more aware, ... (Brand as a Creator of Value) Half of Coca-Cola’s market value today is tied to the brand The value of the Swedish apparel giant H&M’s brand is set at USD 11 billion and Ikea’s at USD billion Behind ... rain that swamped the northern half of Queensland at the start of the year made its way south over the ensuing months and finally filled Brisbane’s dams If it hadn’t, the water grid and desalination...
- 36
- 485
- 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
Ngày tải lên :
16/03/2014, 04:20
... and Leu148 (the innermost peptide bond, near the catalytic site) The atoms shaping the binding environment of the terminal sulfur atom of CoA are listed in Table and shown in Fig Apart from the ... Cys89 is coloured dark blue His156 at the entrance of the pantetheine-binding cavity is coloured orange Note how the CoA interacts mainly with the loop domain and Cys89 (C) A detailed view of the ... catalytic cysteine) and the C-terminal domain The third domain, referred to as the loop domain, protrudes out of the N-terminal domain The loop domain covers the catalytic site and provides the...
- 13
- 472
- 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
Ngày tải lên :
22/03/2014, 21:20
... following primers: 2.1up, AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG ... Parisi G & Ugalde RA (2008) Functional and structural characterization of the catalytic domain of the starch synthase III from Arabidopsis thaliana Proteins 70, 31–40 Senoura T, Asao A, Takashima ... interaction and polysaccharide binding Analysis of the starch-binding capacity of the individual SBDs has indicated that D2 has the highest binding affinity relative to D1 or D3 It is important to...
- 13
- 457
- 0
A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc
Ngày tải lên :
29/03/2014, 19:20
... amassed The early 1990s predictions are available in a searchable database online at the site Imagining the Internet: A History and Forecast and they are also the basis for a book by Anderson ... online Creating a legal and operating environment that allows people to use the internet the way they want, using the software they want Establishing an easy-touse, secure international monetary ... assumptions about the back sides of mountains in Afghanistan and the behavior of entrepreneurs in Africa.” Adrian Schofield, head of research for ForgeAhead, an information and communications consulting...
- 115
- 441
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
Ngày tải lên :
30/03/2014, 04:20
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online ... variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, distinguished...
- 13
- 344
- 0
báo cáo hóa học:" Psychometric properties and the prevalence, intensity and causes of oral impacts on daily performance (OIDP) in a population of older Tanzanians" potx
Ngày tải lên :
20/06/2014, 15:20
... (2) bad Clinical examination One trained and calibrated dentist (IK) conducted all clinical examinations in a shaded area with natural daylight as the source of illumination and with an assistant ... language was mandatory (see additional file 1) Kiswahili is the national and official language in Tanzania and almost all (95%) Tanzanians speak the language proficiently A structured interview ... Tanzania: Kibaha and Bagamoyo districts (rural) in Pwani region and Kinondoni district (urban) in Dar es Salaam city border of the village, folding the paper and randomly picking one name The next...
- 11
- 536
- 0
Báo cáo toán học: "Dissimilarity vectors of trees are contained in the tropical Grassmannian" potx
Ngày tải lên :
08/08/2014, 01:20
... n leaves gives a point in the tropical Grassmannian Gm,n , and therefore gives rise to a tropical linear space The combinatorial structure of those tropical linear spaces is the subject of an ... Gm,n and is called a tropical Grassmannian the electronic journal of combinatorics 17 (2010), #N6 We have the following fundamental characterization of Gm,n which is a direct application of [9, Theorem ... , n} of size m and dσ is the total weight of the smallest subtree of T which contains the leaves in σ By the total weight of a tree, we mean the sum of the weights of all the edges in that tree...
- 7
- 330
- 0
Báo cáo toán học: "Zeros of the Jones polynomial are dense in the complex plane" pdf
Ngày tải lên :
08/08/2014, 12:22
... links By applying BerahaKahane-Weiss’s Theorem and Sokal’s lemma, we prove that zeros of the Jones polynomial of pretzel knots are dense in the complex plane the electronic journal of combinatorics ... ±tk/2 Then by applying Beraha-KahaneWeiss’s Theorem, we obtain the lemma The following Sokal’s lemma [10] will play an important role in proving our main result Lemma 3.3 Let F1 , F2 , G be analytic ... we can further prove that zeros of Jones polynomial of such pretzel knots are dense in the whole complex plane Acknowledgements This paper was partially finished during Xian’an Jin’s visit at the...
- 10
- 302
- 0
Báo cáo y học: " MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppt
Ngày tải lên :
09/08/2014, 01:22
... recruitment and participated in data analysis QR was a reader for the X-rays and assisted in manuscript preparation ER provided statistical advice and assisted in data analysis and manuscript preparation ... bones and metacarpal bases to 5) and fingers (metacarpals proximal to bases, metacarpophalangeal (MCP) joints, proximal phalanges, proximal interphalangeal (PIP) joints, middle phalanges, distal interphalangeal ... preparation MØ participated in the design of the study, was a reader for the MRI scans and assisted in manuscript preparation AD participated in the design of the study, was a reader Available online http://arthritis-research.com/content/11/1/R2...
- 9
- 521
- 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
Ngày tải lên :
09/08/2014, 10:22
... 4:1206-1212 Yoshida R, Nukiwa T, Watanabe Y, Fujiwara M, Hirata F, Hayaishi O: Regulation of indoleamine 2,3-dioxygenase activity in the small intestine and the epididymis of mice Arch Biochem Biophys ... tolerance and immune inhibition in the induction of oral tolerance in the murine CIA model We examined the change in the expression of IDO in CD11c+ DCs of Peyer's patches after repeated oral administration ... arthritis by nasal tolerance Arthritis Rheum 2001, 44:1917-1927 Garcia G, Komagata Y, Slavin AJ, Maron R, Weiner HL: Suppression of collagen-induced arthritis by oral or nasal administration of type...
- 10
- 473
- 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt
Ngày tải lên :
09/08/2014, 13:21
... coordinated acquisition of clinical data and laboratory samples, as well as entry of clinical and laboratory variables into the database All authors participated in revision of manuscript drafts and ... and JOC coordinated the acquisition of laboratory samples, clinical data acquisition, and entry of clinical and laboratory variables into the database TJH, CMTG, and GSC participated in study design ... decreased in a wide variety of diseases that are characterized by autoreactive tissue damage Clin Immunol 2001, 100:144-148 41 Sumida T, Sakamoto A, Murata H, Makino Y, Takahashi H, Yoshida S, Nishioka...
- 13
- 451
- 0
Báo cáo y học: "MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppsx
Ngày tải lên :
09/08/2014, 13:22
... recruitment and participated in data analysis QR was a reader for the X-rays and assisted in manuscript preparation ER provided statistical advice and assisted in data analysis and manuscript preparation ... bones and metacarpal bases to 5) and fingers (metacarpals proximal to bases, metacarpophalangeal (MCP) joints, proximal phalanges, proximal interphalangeal (PIP) joints, middle phalanges, distal interphalangeal ... preparation MØ participated in the design of the study, was a reader for the MRI scans and assisted in manuscript preparation AD participated in the design of the study, was a reader Available online http://arthritis-research.com/content/11/1/R2...
- 9
- 509
- 0