the product of a vector and a scalar is always a vector

THE EFFECTIVENESS OF WORK HEALTH AND SAFETY INTERVENTIONS BY REGULATORS A LITERATURE REVIEW

Ngày tải lên : 02/06/2014, 09:38

83
697
0

Báo cáo hóa học: " Research Article New Trace Bounds for the Product of Two Matrices and Their Applications in the Algebraic Riccati Equation" potx

Ngày tải lên : 22/06/2014, 02:20

18
456
0

Tài liệu Project (written version):“The problems of the “Citibus” (bus operating company) and their possible solutions. Drawing a contract.” doc

Ngày tải lên : 20/12/2013, 19:15

... the roads that doesn’t cope with the growing number of cars and other carriers, build new roads and rearrange the traffic within the city in general); another highly probable reason is that the ... other laws of Ukraine and to make this document has a legal effect). On the next stage both parties sign the contract and we think that the drivers are enough motivated, they fulfil the terms and ... administration doesn’t show the proper interest and enough initiative in solving this particular problem; 3) and the last but not the least problem is the problem of low organization and management...

5
682
0

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Ngày tải lên : 14/02/2014, 13:20

... Transport and urban planning policies can ensure that walking, cycling and other forms of exercise are easy and safe, and address non-motorised modes of transportation. The provision of safe ... diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence of obesity across Europe is a major public health concern ... integrated and comprehensive approach towards the promotion of healthy diets and physical activity V.8.1. A coherent and comprehensive approach aimed at making the healthy choices available, affordable...

22
703
0

Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf

Ngày tải lên : 17/02/2014, 22:20

... Number of Flights and Marginal Products of Year- of- Service Groups 8 Table 2.3. Mission Capable Rate and Marginal Products of Pay Grade Groups 9 Table 2.4. Mission Capable Rate and Marginal Products ... discussion of issues relating to the performance benefits of experience, training, and innate ability and also as a summary of the research already completed in this area. The report will be of particular ... for an additional 1.2 months of seniority. The authors assume that this rise in payment is the value of the additional readiness provided by a 1.2 month increase in average seniority, and they...

87
627
0

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Ngày tải lên : 18/02/2014, 02:20

... own. Although the use of law generally is thought of as coercive and punishing, the coercion also can be positive and of assistance. The use of law can force a behavior that is desirable to the target ... choice, and externalities. Targets that are prone, resistant, or unable to respond to the manager's goal behave on the basis of their motivation, opportunity, and ability and on a manager's ... si- multaneous to, the initial behavior of the target. With public health and social issues, the payback is often vague, uncer- tain, and in the distant future. Exchange theory. Although the exchange...

14
780
0

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Ngày tải lên : 18/02/2014, 11:20

... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... isomerase and comparison with methyl glyoxalsynthase. Adv Protein Chem 66, 315–372. 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disallowed Ramachandran conformations of amino acid residues ... [27] and also in maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIM sequences from various sources facilitate...

15
635
0

Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx

Ngày tải lên : 19/02/2014, 12:20

... using IMAGEQUANT software, and depurination was calculated by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressing values as a percentage. Reassociation and quantiﬁcation of ... collection and reﬁnement statistics are given in Table 1. Assay of the N -glycosidase activity of ricin A chain variants The activity of each of the RTA variants was determined by assessing their ability ... using IMAGE- QUANT software. The depurination was calculated by relating the amounts of small aniline-fragment and 5.8S rRNA and expressing values as a percentage. Symbols indicate the experimental...

10
616
0

Tài liệu A Review of the Uses of Poultry Eggshells and Shell Membranes doc

Ngày tải lên : 21/02/2014, 01:20

... accident can cause and the social disadvantage such disfigurement can mean (Jamie, 2009). They would live with emotional pain from the fire, long after the physical pain from the same had healed. ... improve the healthy late post-menopausal women with an adequate engineering characteristics and performance. When the Calcium intake at baseline may increase bone mineral mechanical stability of soil ... membrane collagen is very low in autoimmune and allergic reactions as well as high in bio-safety and is of similar characteristics to other mammalian collagen. Eggshells/shell membranes have multiple...

5
761
1

"The Potential of Cellulosic Ethanol Production from Municipal Solid Waste: A Technical and Economic Evaluation" doc

Ngày tải lên : 09/03/2014, 00:20

... paper, cardboard, ADC final, woody waste, ADC green, and grass wastes. Among these fractions, ADC final and ADC green are the fractions that will be sent to landfills with the median average ... amount of impurities in raw ADC final, grass waste, woody waste and cardboard was removed after pretreatment probably because of the solubilization of organics in pretreatment filtrate. Table ... over the lifecycle of the biofuels supply chain” [DOE-EPA]. Clearly, MSW is an attractive cellulosic resource for sustainable production of transportation fuels and chemicals because it is an abundant...

41
554
0

Philosophy in a New Key A Study in the Symbolism of Reason, Rite, and Art

Ngày tải lên : 14/03/2014, 17:25

... characteristic of man among the animals. The study of symbol and meaning is a starting-point of philosophy, not a derivative from Cartesian, Humean, or Kantian premises; and the recognition of ... physiological and from a behav- ioristic angle. Its fundamental standpoint is that the responses of an organism to the environment are adaptive, and are dic- tated by that organism's needs. ... considers man the highest animal, and his supreme desires as products of his supreme mind; and another which regards him as the lowest spirit, and his unique long- ings as a manifestation of his otherworldly...

255
564
0

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Ngày tải lên : 15/03/2014, 00:20

... assembly. An alternative explana- tion that can account for this observation is that Ssa1p binds with higher afﬁnity a conformational state of Ure2p as a result of the presence of the N-terminal domain ... mode. An external calibration was performed using standard peptide solution Cal Mix1 and Cal Mix2 (Applied Biosystems) and an additional internal calibration was performed during mass spectra analysis using ... peptides. The list of light and heavy precursor masses was further used either to analyze the MS ⁄ MS spectra acquired in the data-depen- dent acquisition analysis or to build an inclusion list with the...

12
510
0

HYGIENIC PHYSIOLOGY WITH SPECIAL REFERENCE TO THE USE OF ALCOHOLIC DRINKS AND NARCOTICS BEING A REVISED EDITION OF THE FOURTEEN WEEKS IN HUMAN PHYSIOLOGY ppt

Ngày tải lên : 15/03/2014, 13:20

... consists largely of animal matter, and so is tender and pliable. The utmost care is therefore necessary to prevent a malformation. THE JOINTS are packed with a soft, smooth cartilage, or gristle, ... bone of the thumb, standing apart from the rest, enjoys a special freedom of motion, and adds greatly to the usefulness of the hand. FIG. 12. [Illustration: _Bones of the Hand and the Wrist._] ... years together, without being weary."] The muscles are nearly all arranged in pairs, each with its antagonist, so that, as they contract and expand alternately, the bone to which they are...

532
562
0

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Ngày tải lên : 16/03/2014, 05:20

... (open bar) and thoracic ganglia (diago- nally shaded bars) of females. The percentage indicates the GSI of the females. M (B) indicates the expression pattern of MIH-B in the same tissues in males ... 5). The lower panel is the northern blot analysis of MeMIH-B expression in the eyestalk (Es) and thoracic ganglia during the gonad maturation cycle. Each lane repre- sents an RNA sample from the ... Tsutsui N, Saido-Sakanaka H, Yang WJ, Jayasankar V, Jasmani S, Okuno A, Ohira T, Okumura T, Aida K & Wilder MN (2004) Molecular characterization of a cDNA encoding vitellogenin in the coonstriped...

11
546
0

A pharmacopoeia including the outlines of materia medica and therapeutics for the use of practitioners and students of veterinary medicine pdf

Ngày tải lên : 23/03/2014, 00:20

... or other areas where access to a large amount of text is helpful, please contact us. We encourage the use of public domain materials for these purposes and may be able to help. + Maintain attribution ... difficult to discover. Marks, notations and other marginalia present in the original volume will appear in this file - a reminder of this book’s long journey from the publisher to a library and finally ... alt="" This is a digital copy of a book that was preserved for generations on library shelves before it was carefully scanned by Google as part of a project to make the world’s books discoverable...