0

the pressure gradient in flow through a packed bed of spheres

Báo cáo y học:

Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"

Y học thưởng thức

... extending above a line tangential to the supraorbital margin (horizontal line) Frontal sinus aplasia is also defined by an oval-shaped sinus with the lateral margin medial to a vertical line drawn ... Frontal sinus aplasia was also defined by an oval-shaped sinus with the lateral margin medial to a vertical line drawn through the middle of the orbit (vertical line) with a smooth superior margin ... light was centered at the level of the sinus, indicating the optimized center of the reconstruction area In addition, the head position was adjusted in such a way that the hard palate was parallel...
  • 5
  • 577
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

Báo cáo khoa học

... of indexing and recalling a considerably larger 17 body of resonant combinations than the average human The necessary barrage of linguistic stimuli can be provided by the Google 1T database of ... readymade In this casual inspiration phase, the observant writer recognizes that a certain combination of words may produce, in another context, a meaning that is more than the sum of its parts ... trouvés as “assisted readymades” because they allow an artist to remake the act of creation as one of pure insight and inspired recognition rather than one of manual craftsmanship (see Taylor,...
  • 6
  • 442
  • 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học

... following the decrease in A4 56 Data analysis Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporated into the origin software package ... Expression and purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... Inc., Palo Alto, CA, USA) The concentration of benzylamine was typically in the range 0.02–2 mm, and the assay was started by the addition of MAO A to a final concentration of 0.6 lm Michaelis–Menten...
  • 9
  • 327
  • 0
Reducing Childhood Obesity in Ontario through a Health Equity Lens docx

Reducing Childhood Obesity in Ontario through a Health Equity Lens docx

Cao đẳng - Đại học

... support, and other social determinants of health These determinants interact and reinforce each other Thus people who are at the disadvantaged end of the gradient of health are more likely to lack access ... better off Contributors to poor health include poverty, a lack of safe and affordable housing, inadequate access to good food, being socially marginalized, and faring poorly in a range of other ... how addressing the social determinants of childhood obesity can improve the health of children in Ontario Pervasive health inequities are rooted in social determinants of health There is a gradient...
  • 13
  • 322
  • 0
the impact of corporate cultural in vietnamese companies a case study of vietinbank, hoan kiem branch

the impact of corporate cultural in vietnamese companies a case study of vietinbank, hoan kiem branch

Sư phạm

... such as Saigon Bank for Commerce and Industry; Indovina Bank (the first joint-venture bank in Vietnam); Vietnam International Leasing Company – VILC (the first financial leasing company in Vietnam) ... behavior and the reasons that govern behavior Qualitative methods also are investigating why and how of decision making So the smaller samples are more focused than large samples 25 The advantage ... them and at the same time, heighten these values Beside the role of shaping and managing corporate culture’s values, the leader has to change them according to the requirement of changing strategy...
  • 78
  • 825
  • 1
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học

... catalytic cysteine) and the C-terminal domain The third domain, referred to as the loop domain, protrudes out of the N-terminal domain The loop domain covers the catalytic site and provides the ... reflecting the overall ˚ (4.7 A weakening of the sulfur–sulfur van der Waals interactions in the CoA binding mode of the C8 9A variant, especially concerning Met157 (Table 2), in addition to the absence ... sulfur–sulfur interactions in defining the catalytically competent binding mode of CoA in the active site The pantetheine binding tunnel of biosynthetic thiolase When CoA binds to Z ramigera biosynthetic...
  • 13
  • 472
  • 0
The Diesel Exhaust in Miners Study: A Nested Case–Control Study of Lung Cancer and Diesel Exhaust pptx

The Diesel Exhaust in Miners Study: A Nested Case–Control Study of Lung Cancer and Diesel Exhaust pptx

Sức khỏe giới tính

... potential confounding factors These included a variable that combined cigarette smoking status and smoking intensity with location worked because initial analyses indicated that the risk of lung cancer ... particulate organic/elemental carbon in the atmospheres of Chesapeake Bay, USA Atmos Environ 2001;35(32):5663–5677 Funding The research was funded by the Intramural Research Program of the National ... subjects were individually matched to each case subject on mining facility, sex, race/ethnicity (ie, white, African American, American Indian, Hispanic), and birth year (within years) In the analysis,...
  • 14
  • 328
  • 0
Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

Báo cáo khoa học

... acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 249 amino amino amino amino amino 266 266 266 266 278 AATAAA ⁄ 13 nucleotides AATAAA ⁄ 13 nucleotides AATAAA ⁄ 10 nucleotides AATAAA ⁄ 13 nucleotides ... Perera et al 3498 25 25 25 25 27 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 amino amino amino amino amino 15 15 15 15 15 acids acids acids acids acids amino amino amino amino amino acids ... peptide Accession number Reference Spiny lobster Panulirus argus MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA KSLILCVLLAGAFA KSLVLCLLLAGAFA KSLVLCLLLAGAFA MKTLVFCLLLVGALA APSGKPKFRRGLNK...
  • 13
  • 474
  • 0
báo cáo sinh học:

báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx

Điện - Điện tử

... remainder of the analysis was carried out using the data extraction form and the analytical framework presented in the following section Analytical framework The concept of "quality of care" was defined ... affect the availability of HR for EmOC They point out that these staff shortages weaken the quality of care by increasing professionals' workloads and patients' waiting times and making infection ... performance Variations in their quality are rapidly expressed as changes in measurable outcomes such as maternal and infant mortality Moreover, the technical nature of EmOC and the necessary interaction...
  • 12
  • 640
  • 0
báo cáo sinh học:

báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot

Điện - Điện tử

... remain, further increasing turnover [9] The implications of these findings are therefore alarming for the provision of health care in South Africa now and in the future, given that we are already ... Happel B, Martin T, Pinikahana J: Burnout and Job satisfaction: a comparative study of psychiatric nurses from forensic and mainstream mental health service International Journal of Mental Health ... satisfaction, individual and organizational characteristics Journal of Advanced Nursing 2000, 32(3):536-543 Kaplan RA, Boshoff AB, Kellerman AM: Job involvement and job satisfaction of South African...
  • 10
  • 514
  • 1
báo cáo hóa học:

báo cáo hóa học:" Cartilage contact pressure elevations in dysplastic hips: a chronic overload model" potx

Hóa học - Dầu khí

... to investigate the link between abnormal mechanical load and the earlier-thannormal development of osteoarthritis in a natural hip in the absence of any known trauma or surgical intervention All ... trauma in the hip There was a significant reduction in contact area from the Visible Human control to the asymptomatic acetabulae and femoral heads Overall calculated contact areas, ranging from ... to their standard clinical followup The arthrogram protocol involved injection of a radioopaque contrast agent into the joint space, which adhered to cartilage surfaces Then the cartilage was...
  • 11
  • 299
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Status of an indigenous agro-forestry system in changing climate: A case study of the middle Himalayan region of Tehri Garhwal, India" potx

Báo cáo khoa học

... Study area The present study was carried out in the Hisriyakhal group of villages of Tehri Garhwal district in the Uttarakhand state of India The Uttarakhand state lies in the northern region of India ... India and spans 14 over an area of 53,485 km2 Of the total 8,479,562 human population of the state, 78% lives in rural areas The agriculture land in the hills of Uttarakhand is scattered and fragmented ... villages had about 42 of land under agroforesty that was treated annually by about 400 quintals of cow dung as farm yard manure A part of the cattle dung was also used as fuel by sun drying The agriculture...
  • 8
  • 440
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Evaluation through a simulation model of nutrient exports in fast-growing southern European pine stands in relation to thinning intensity and harvesting operations" doc

Báo cáo khoa học

... study was to calculate the accumulation and the export of nutrients over time in Pinus pinaster (maritime pine) and Pinus radiata (radiata pine) stands under a range of silvicultural alternatives, ... the case of radiate pine, and for K in the case of maritime pine Even in the traditional harvest of no debarked logs, the exports of P and K in radiate pine plantations would be higher than the ... 24 in radiata pine and from SI 12 to 20 in maritime pine, in both cases at a reference age of 20 years, and considering in this case the conventional harvesting of no debarked logs Finally, the...
  • 10
  • 304
  • 0
Báo cáo y học:

Báo cáo y học: "IGF-1 regulates cAMP levels in astrocytes through a β2-adrenergic receptor-dependant mechanism" pot

Báo cáo khoa học

... (β2AR -/-) was generated by homologous recombination resulting in the insertion of a neomycin resistance gene cassette into the fourth transmembrane domain of the β2-AR gene These mice are viable, ... Int J Med Sci 2008, adenylyl cyclase pathway, which enhances cAMP, leading to PKA activation and further phosphorylation of down stream targets Because of the importance of both the β2 adrenergic ... absorption was spectrophotometrically measured at 450nm A cAMP standard was provided for quantitative calculation of cAMP concentrations of astrocyte samples per well Statistical analysis All experiments...
  • 4
  • 286
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Lymphatic mapping and sentinel node biopsy in gynecological cancers: a critical review of the literature" pot

Báo cáo khoa học

... in the parametrial areas [35], whereas Levenback found 9% of the sentinel nodes in the paraaortic area, 11% in the common iliac, 71% in the external iliac, and 9% in the parametrial area in a ... Although majority of the nodes are located in internal iliac and external iliac areas, nodes have been found in also presacral, parametrial and pararectal areas [33] In a sentinel node study carried ... 90% are squamous cell carcinomas, while the rest are melanoma, adenocarcinoma, basal cell carcinoma and sarcoma [7] Nodal metastasis in vulva cancer is the main prognostic factor, irrespective of...
  • 12
  • 511
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Delineation in thoracic oncology: a prospective study of the effect of training on contour variability and dosimetric consequences" potx

Báo cáo khoa học

... physicians, reflecting the necessity of training Delineation variations are a source of error in the planning and execution of radiotherapy Regarding the treatment planning consequences of the variability ... INTRODUCTION: The variability among radiation-oncologists in the delineation of GTV for lung cancer has already been described [1-4] These variations are a major source of error in the planning and execution ... results in lower tumor control and increased toxicity [3] During the national training of French radiotherapy residents, a comparison of residents’ delineation of the same clinical case of non small...
  • 24
  • 376
  • 0
Báo cáo y học:

Báo cáo y học: "ACR70-disease activity score remission achievement from switches between all the available biological agents in rheumatoid arthritis: a systematic review of the literature" doc

Báo cáo khoa học

... 'clinical trials phase II', 'clinical trials phase III', and 'clinical trials phase IV' We searched even in the abstract databases of both the European League Against Rheumatism (EULAR) and the ... AL, and GF conceived of the study and participated in its design and coordination, in data acquisition and analysis, and in manuscript preparation EG and AZ participated in data acquisition and ... abatacept-treated patients who failed treatment with TNFα blockers In the Abatacept Trial in Treatment of Anti-TNF Inadequate Responders (ATTAIN), abatacept was studied in RA patients who failed anti-TNFα...
  • 7
  • 456
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study" ppsx

Báo cáo khoa học

... been associated with hypo- and hyper-kalemia and paralysis [7], and here it was found in two cases In one family the mutation was co-inherited with a mutation in troponin T and in another the ... subjected to a full clinical evaluation including family history, physical examination, echocardiography and ECG All fulfilled classical diagnostic criteria for HCM [37,38] The mean age of index patients ... variants and disease was assessed by comparing the distribution of variants in disease group and controls c2-testing was used to examine for significant association using a level of significance...
  • 5
  • 444
  • 0
Báo cáo y học:

Báo cáo y học: "The boy who refused an IV: a case report of subcutaneous clodronate for bone pain in a child with Ewing Sarcoma" pot

Báo cáo khoa học

... difficulty taking oral medications At the time of treatment his weight was 23 kg He had multiple pain complaints including headache, back pain and generalized arthralgia/myalgia There was a particularly ... troubling bone pain involving his forearms, wrists and hands bilaterally The arm pain was unpredictable, episodic and intense with aching and burning qualities There were no shooting pains or ... for nausea PEG 3350 and docusate were used as laxatives The above regimen achieved satisfactory analgesia for all his pains except for bone pain in the arms The clinical team opted to try a bisphosphonate...
  • 4
  • 423
  • 1
Báo cáo y học:

Báo cáo y học: "Peripheral primitive neuroectodermal tumor of the urinary bladder in an Arab woman with history of squamous cell carcinoma: a case report" doc

Báo cáo khoa học

... and the dome of the urinary bladder (another site than described for the squamous cell carcinoma) As an initial attempt at transurethral resection (TUR) resulted in perforation, a partial bladder ... 67-year-old diabetic and hypertensive Arab woman in February 2006, due to severe hematuria and fever In January 2005, the woman had already been treated in a hospital of Great Britain for repeated ... secondary tumor We report the first case of a peripheral primitive neuroectodermal tumor of the urinary bladder in an Arab country The Department of Surgery of Al Sabah Hospital, Kuwait admitted a...
  • 4
  • 306
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008