the new color constructor function creates a new color object the new color object is called mycolorobject and is associated with the movie clip called shirt
Báo cáo y học: " A high serum level of eotaxin (CCL 11) is associated with less radiographic progression in early rheumatoid arthritis patients" doc
Ngày tải lên :
09/08/2014, 10:23
... participated in study design and coordination, assisted in drafting the manuscript, and EAH and PB participated in study design and coordination, read and interpreted the MRIs and X-rays TL analyzed ... [4] Clinical examination, X-rays of hands, magenetic resonance imaging (MRI) of the dominant wrist and laboratory analyses were assessed at baseline and after 3, and 12 months The patients received ... organizing the data collection, Halvor Gilboe for practical assistance with CRFs, Marianne Ytrelid for technical assistance, and Dr Inge Olsen for statistical advice and Drs Annelies Boonen and...
- 4
- 322
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
Ngày tải lên :
26/10/2012, 10:04
... whether there is an association between the NPPB gene and EH Acknowledgments We would like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama ... AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part of the ... gene and its association with essential hypertension and left ventricular hypertrophy in the Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation...
- 7
- 612
- 1
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
Ngày tải lên :
23/03/2014, 09:20
... vector as template DNA Primer 1, 5Â- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, was designed to add a sequence encoding Apamin and a linker cleavable by thrombin and Fx proteases at an ... mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a- toxins and their mutants ... this toxin on insect as well as mammalian peripheral and brain Navs [5,16,18] A similar explanation might hold for the slow effect on toxicity and a broad range of activity of the site-3 sea anemone...
- 14
- 206
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
Ngày tải lên :
29/03/2014, 00:20
... static, assisting the reliable calculations of the total amount of CaCl2 added What is apparent from Fig 1A, B is that both ADP and ATP significantly decreased Ca2+ uptake rates as compared with ... four amino acids Finally, we show that the ADP–ATP exchange rate mediated by ANT expressed in mitochondria of A franciscana and Ca2+ uptake capacity are insensitive to BKA Resistance to BKA may ... in the designated areas a, b, and c Yellow represents the part of the bovine ANT that is different from the Artemia ANT; the latter is depicted in magenta Regions a, b and c are marked on the aligned...
- 15
- 505
- 0
Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot
Ngày tải lên :
29/03/2014, 09:20
... (21 aa) and an intracellular portion (567 aa), containing a kinase homology (KH) domain, the dimerization domain and the C-terminal catalytic GC domain [1,7] In the absence of ligand, GC -A forms ... with anti-FLAG IgG Western blot analyses with antibodies against PMCA, as a marker for the cell membrane, and extracellular signalregulated kinase ⁄ (ERK1 ⁄ 2), as a marker for the cytosolic fraction, ... that cell fractionation led to a good separation of the membrane from the cytosolic proteins and from cell debris and nuclei (Fig 2A) Western blot analyses with antibodies against FLAG and against...
- 14
- 313
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
Ngày tải lên :
18/06/2014, 15:20
... described as an inferred haplotype Statistical analysis of genotype distribution and allele frequency was done by chi-square Test and Fischer's exact Test where applicable The analysis of statistical ... presented as mean and range of values death due to severe sepsis compared to patients without allele CATT7 The concomitance of the -173 allele C and the -794 allele CATT7 as a haplotype was significantly ... In the sepsis patient sub groups female and male patients as well as patients with age ≤60 years and in patients with non-pulmonary or non-abdominal focus the haplotype was associated with poor...
- 8
- 554
- 0
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
Ngày tải lên :
18/06/2014, 16:20
... assisted with the statistical analysis JM assisted with data collection and helped to draft the manuscript JB assisted with collection of clinical data MU assisted with data collection and participated ... data collection DPO participated in the data collection JE participated in the design of the study and helped draft the manuscript MAK assisted with the data collection and helped draft the manuscript ... (two-sided) Kaplan Meier analysis demonstrated that increased RBM3 mRNA levels were associated with a significantly prolonged RFS and OS (Fig 2A and 2B) Cox univariate analysis confirmed this association...
- 12
- 531
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
Ngày tải lên :
19/06/2014, 08:20
... participated in the design of the study and helped to draft the manuscript, GT, APL and HIK helped to draft the manuscript and contributed to the revision All authors read and approved the final manuscript ... functional plasticity is a characteristic feature of motor cortex, and that motor behaviour associated with skill learning is crucial in shaping the functional organization of M1 [27], further investigation ... repetitive wrist training We proposed to test muscles controlling the wrist that are located in the proximal forearm area and that have a more defined functional agonist-antagonist role We hypothesized...
- 8
- 432
- 0
Báo cáo hóa học: " A predominance of R5-like HIV genotypes in vaginal secretions is associated with elevated plasma HIV-1 RNA levels and the absence of anti-retroviral therapy" docx
Ngày tải lên :
20/06/2014, 01:20
... sample preparation, carried out data analysis, and drafted the manuscript PK participated in the study design and conducted the statistical analyses RC participated in the design and coordination ... directed sample and data analysis, and assisted in drafting the manuscript Acknowledgements We wish to thank Nurse Practitioners Jeanne Dumestre and Louann Wenthold for their assistance with this study ... coordination of the study and facilitated the collection of clinical samples NL processed clinical samples and conducted PCR and viral load analyses AA participated in the coordination of the study,...
- 4
- 481
- 0
báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx
Ngày tải lên :
20/06/2014, 07:20
... proteomic analysis of ovarian cancer ascites demonstrated that malignant cells from ascites have higher levels of activated Akt and discriminated malignant ascites and poor survival outcomes [26] This ... associated with outcome in patients with ovarian cancer In a study by Conner and Felder the inhibitory effect of ovarian cancer ascites was associated with platinum resistance [30] Lancaster et al ... A: High expression of tumor necrosis factor-related apoptosis-inducing ligand is associated with favourable ovarian cancer survival Clin Cancer Res 2003, 9:762-766 Kayagaki N, Yamaguchi N, Nakayama...
- 10
- 383
- 0
Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc
Ngày tải lên :
09/08/2014, 06:22
... hemorrhages and giant capillaries, moderate loss of capillaries with some avascular areas, mild disorganization of the capillary architecture and absent or some ramified capillaries Finally, the late pattern ... was to analyze whether a decrease of the angiogenic factors VEGF and bFGF and an increase of the angiostatic factor endostatin contribute to the impaired angiogenesis in patients with SSc, and ... endostatin and bFGF and other clinical parameters No correlation of VEGF, endostatin and bFGF levels with skin score, carbon monoxide diffusion capacity and the presence of teleangiectasias and other...
- 10
- 432
- 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
Ngày tải lên :
09/08/2014, 07:20
... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 ... allele1VIC-TGAAGACCCTGGGC-MGB SNP6R CCCGAAGTCCGAGCACC SNP6 allele2 FAM-TGAAGACCCCGGGC-MGB SNP9F GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 ... FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGATCAC SNP5 allele1 VIC- TCGGGAGTTCGAGACC-MGB SNP5R ACACAGGGTTTCACCATGCT SNP5 allele2 FAM- CGGGAGTTGGAGACC-MGB SNP6F TCCCTACTGTTGTTTCCGCC SNP6 allele1VIC-TGAAGACCCTGGGC-MGB...
- 9
- 559
- 0
Báo cáo y học: "The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study" docx
Ngày tải lên :
09/08/2014, 10:20
... A Balsa and D Pascual-Salcedo (Spain); M Spyropoulou and C Stavropoulos (Greece); P Migliorini and S Bombardieri (Italy); P Barrera and L Van de Putte (Netherlands); andH Alves and A Lopes-Vaz ... same characteristics as sample 1, except for a shorter mean disease duration and a different ethnic origin (Caucasian families from France, Italy, Portugal, Spain, Belgium, and The Netherlands) ... a first sample of French Caucasian families, the same trend in replication sample 2, and again a significant association in replication sample (European Caucasian families) Finally, significant...
- 7
- 605
- 0
Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx
Ngày tải lên :
09/08/2014, 14:22
... use and care of live animals and were approved by the Animal Care and Use Committee of National Institute of Dental and Craniofacial Research Acute and chronic joint pathology was clinically ... for total TGFβ quantification in the plasma after a 1/20 dilution by ELISA (Promega, Madison, WI, USA) following the manufacturer's instructions Statistical analysis Group comparisons of parametric ... CA, USA) For surface staining, cells were incubated with FITC-conjugated anti-rat CD4 (Caltag, San Francisco, CA, USA) and allophycoyanin-conjugated antiCD25 mAbs (BD Biosciences, San Jose, CA,...
- 8
- 310
- 0
Báo cáo y học: " A promoter SNP rs4073TA in the common allele of the interleukin 8 gene is associated with the development of idiopathic pulmonary fibrosis via the IL-8 protein enhancing mode" docx
Ngày tải lên :
12/08/2014, 13:22
... the statistical analysis The inter- and intraassay coefficients of variance were below 10% Protein concentration of BAL samples was measured for standardization using a micro BCA protein assay ... were managed and analyzed using SAS version 9.1 (SAS Inc., Cary, NC, USA) Statistical power of single associations was calculated with false-positive rate of 5% and four given MAFs and sample ... for calculating relative hazards and P-values controlling age, sex and smoking status[20] Mantel-Haenszel chi-square (MHC) tests were used to test for trend in the categorical analysis The data...
- 7
- 284
- 0
Báo cáo y học: "A GA microsatellite in the Fli1 promoter modulates gene expression and is associated with systemic lupus erythematosus patients without nephritis" potx
Ngày tải lên :
12/08/2014, 15:22
... of the data JLS participated in the data analyses and writing of the manuscript DLK and GSG provided the gDNA samples and demographic information for the cohorts and contributed to the data analyses ... the study, designed the experiments and contributed to all aspects of the data collection and analyses and drafting and editing of the manuscript All authors read and approved of the final manuscript ... Martin-Donaire T, Losada-Fernandez I, Perez-Chacon G, Rua-Figueroa I, Erausquin C, Naranjo-Hernandez A, Rosado S, Sanchez F, Garcia-Saavedra A, Citores MJ, Vargas JA, Perez-Aciego P: Association...
- 9
- 268
- 0
Báo cáo y học: "(Sub)clinical cardiovascular disease is associated with increased bone loss and fracture risk; a systematic review of the association between cardiovascular disease and osteoporosis" ppsx
Ngày tải lên :
12/08/2014, 15:22
... between cardiovascular disease and osteoporosis The following search terms for cardiovascular disease were used: cardiovascular diseases, cerebrovascular diseases and peripheral vascular diseases These ... postmenopausal women with osteoporosis Maturitas 2006, 55:212-218 61 Sumino H, Ichikawa S, Kasama S, Takahashi T, Sakamoto H, Kumakura H, Takayama Y, Kanda T, Murakami M, Kurabayashi M: Relationship ... Bauer DC, Harris T, Johnson KC, Taaffe DR, Cauley JA: Volumetric and areal bone mineral density measures are associated with cardiovascular disease in older men and women: the health, aging, and...
- 19
- 500
- 0
Báo cáo y học: "Early drotrecogin alpha (activated) administration in severe sepsis is associated with lower mortality: a retrospective analysis of the Canadian ENHANCE cohort" ppsx
Ngày tải lên :
13/08/2014, 16:20
... severity markers for the Canadian sample Baseline demographics, disease severity, and clinical variables that were associated with mortality were compared in a bivariate analysis between survivors and ... interval; DrotAA = Drotrecogin alfa activated readily available variables may be potential early clinical predictors of outcome, and that, when indicated, early rather than late administration ... severe sepsis was associated with new organ failure and increased mortality at 28 days [18] Data from an integrated sepsis database also provides evidence that serum creatinine change within the first...
- 10
- 309
- 0
Báo cáo y học: " Endothelial Blood transfusion during cardiac surgery is associated with inflammation and coagulation in the lung: a case control study" pptx
Ngày tải lên :
14/08/2014, 07:21
... instrumental in data gathering and analysis He read the final version of the manuscript and agrees with all reported findings and interpretations ML was instrumental in performing the coagulation and ... fibrinolysis assays and helped to draft the manuscript He read the final version of the manuscript and agrees with all reported findings and interpretations JCMM was instrumental in data analysis and ... amount of transfusion was associated with longer mechanical ventilation in the ICU The finding that blood transfusion is associated with inflammation and activation of coagulation and impaired fibrinolysis...
- 11
- 387
- 0
Gait initiation time is associated with the risk of multiple falls—a population based study
Ngày tải lên :
25/08/2016, 21:39
... if there were any contraindications to having a MRI scan Participants with Parkinson’s disease and dementia were excluded due their know effects on GI and falls The Southern Tasmanian Health and ... analyses All models were adjusted for age and sex Other falls risk measures of physiological and psychological function were added to the models if associated with falls and the relevant variable changed ... under single and dual task in the overall sample and for each category of falls (p < 0.05), but not for transfer or swing time (p > 0.05) 5.2 Gait initiation and single falls Data analysis Differences...
- 6
- 224
- 0