the need to shift the learning paradigm from machine learning from examples to machine teaching by rules at the first stage of a two stage hybrid remote sensing image understanding system part ii novel developments and conclusions
Báo cáo hóa học: " Research Article Optimum Detection of Ultrasonic Echoes Applied to the Analysis of the First Layer of a Restored Dome" pot
... give an adequate balance between resolution and the capacity to penetrate into the mortar It should be noted that mortar is a material composed of sand and cement paste Two essential parts of its ... (separation between two consecutive locations was cm) crossed some areas where modifications had been made to the surface (a special type of paper was attached to the wall after preparation of the ... that prior knowledge of the actual dome The interest for the restorer is to have information about the state of the layers in some specific areas of the domes; in this particular case to know the...
- 10
- 386
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... inverse The increase of photon intensity of one mode makes the decrease of the one of other mode The reason perhaps is due to the conservation of energy in the operation of two- mode random microlaser ... one of parameters in table and remain invariable all the rest of parameters The obtained results are shown in Section 3 Influences of laser parameters on saturated photon densities 3.1. Gain coefficients ... operation of two- mode random microlaser, the variation of laser parameters influences clearly on the transformation of mode photon densities With each parameter, its influence on two modes almost...
- 4
- 343
- 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... each relation the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of ... presegmented and original format The part of the corpus that has been annotated contains about 20,000 words The annotation tools, that we have developed, use an HTML editor For chunk marking, the annotator ... of syntactical phenomena as broad as possible in order to allow any parser to participate, whatever the grammatical formalism it uses We have decided immediately upon a twosteps annotation: first...
- 4
- 323
- 0
Báo cáo toán học: "The subword complexity of a two-parameter family of sequences" pps
... journal of combinatorics (no 2) (2001), #R10 18 [16] A. M Yaglom and I.M Yaglom, Challenging Mathematical Problems with Elementary Solutions, Vol II, Holden-Day, San Francisco, translated by J McCawley, ... way, it follows that both 0u and 1u are factors of F Suppose that u contains no Then Lemma implies that |1u| < 2s + t, so we have u = 1k , k < 2s + t − On the other hand, suppose that u contains ... sequences A characterized by F The sequence A is defined to be a Beatty sequence if there exist real α, β such that An = nα + β for all n ∈ >0 It turns out that A is √ a Beatty sequence if and only...
- 19
- 293
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... noun-noun and verbverb pairs, and elesk for other pairs (Sinha and Mihalcea, 2007) used to be the state -of -the- art system on SE2 and SE3 Experiment Results The disambiguation results (K = 100) are ... sj In WMF, the original matrix X is factorized into two matrices such that X ≈ P Q, where P is a 141 K × M matrix, and Q is a K × N matrix In this scenario, the latent semantics of each word wi...
- 5
- 585
- 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... corresponding to the mature peptide of MeMIH-B was amplified by PCR using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) ... 20) at different gonad maturation stages of the eyestalk (open bar) and thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the ... the hepatopancreas and ovary to increase the rate of vitellogenin gene expression, indicating that both the hepatopancreas and ovary are the targets of MeMIH-B This result will provide the basis...
- 11
- 546
- 0
Báo cáo lâm nghiệp: " from the simple application of a mixture of to more gibberellins integrated explanations" pot
... Changes in cytokinin and gibberellin-like substances in Pinus radiata buds during lateral shoot initiation and the characterization of ribozyl zeatin and a novel ribozyl zeatin glycoside Plant ... in the shoots just after stem girdling and at the end of the flooding treatment Flooding had an especially dramatic and long lasting effect, since 73 days after treatment the levels of ACC and ... considered to be very important for sexual differentiation (Durand and Durand, 1984) Thus quantitative as well as qualitative variations must be analyzed Curiously, little attention has been paid to...
- 7
- 275
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... addition to an amplitude histogram, which generates a large inventory of normalized mathematical indexes of abnormality It is the pattern of these mathematical indexes of abnormality, obtained from analysis ... resulting mathematically integrated patterns of the abnormal indexes are then compared for their degree of abnormality to the abnormal index patterns in the reference database to reach a final diagnostic ... were attached from the MCG machine to the patient at the four standard limb lead and precordial lead V5 positions An automatic 82-second simultaneous two- lead (leads V5 and II) ECG sample was acquired...
- 13
- 684
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... lgÆmL)1 ampicillin, sodium salt, 50 lM iron(III) sulfate and 50 lM manganese sulfate When the D600 of the culture reached a value of 0.4, IPTG was added to a final concentration of 10 mM and the culture ... were added to sodium azide at the appropriate concentration to yield the required concentration of azide in the complete assay solution, and assayed immediately At least three independent measurements...
- 12
- 740
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... re-construct the sub-tree at IO parent state P ∗ moving it to the same level as state N ∗ , where the states of P ∗ and N ∗ now share the same parent, state S (9) where x and y are words adjacent to each ... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... analysing the results over two sets of data The first is a selection of data from CoNLL2004 and contains 8936 sentences The second dataset is part of the Lancaster Treebank corpus and contains 1473...
- 8
- 528
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... pET2 8a( +)-wild-type Ec DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and...
- 14
- 390
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... Incubation temperature was 37 °C At the stated times, aliquots were inactivated by addition of mL 5% trichloroacetic acid and heated at 90 °C for 15 Radioactivity bound to protein was measured ... dividing the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody Capabilities of nitrotyrosinated and ... brain was able to release approximately 30% of [14C]nitrotyrosine and approximately 40% of [14C]tyrosine in a 1-h period These results indicate that tyrosinated and nitrotyrosinated Table Capability...
- 9
- 518
- 0
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
... nonradioactive ATP were added After the addition of Q-0 and/ or ATP samples were taken immediately and after 0.5, 1, 2, 4, 8, 16 and 32 min; the reaction was stopped by the addition of sample buffer The half-life ... subtilis was recently shown to be a catalytic ATP-binding domain [31] As the PAS domain of BvgS contains a putative ATP binding site and mutations in this motif were previously shown to inactivate the ... 3480 A Bock and R Gross (Eur J Biochem 269) kinase ArcB together with the response regulator ArcA regulates the expression of many genes which are involved in the adaptation of the bacteria during...
- 6
- 421
- 0
facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures
... sawtooth morphology we can speculate that the formation of 1-D nanostructure may have come from the nanoparticle aggregation, at the same time oriented aggregation and particle fusion may have ... (HRTEM) image and the corresponding SAED pattern Like the XRD profile, the HRTEM image and the SAED pattern may also be indexed to hexagonal phase of α-Fe2O3 The observed lattice spacings of 0⋅370 and ... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 180°C for...
- 5
- 519
- 0
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx
... Reykjavik, Iceland), and were refined by varying the pH of the buffer and the concentration of the precipitant Prior to data collection, a crystal was transferred into Analysis of substrate specificity ... calculated from a plot of initial reaction rates versus substrate concentration using Prism (GraphPad Software, San Diego, CA, USA) One unit was defined as the amount of enzyme that released lmol of ... procedure (Stratagene) with primers 5¢-TCTTCAGCGGC ATGGGCGACCTCGGCGGCAT-3¢ and 5¢-ATGCCGC CGAGGTCGCCCATGCCGCTGAAGA-3¢ The recombinant protein was purified using a HiTrapÔ chelating column and Resource...
- 7
- 361
- 0
Báo cáo khoa học: The crystal structure of a hyperthermostable subfamily II isocitrate dehydrogenase from Thermotoga maritima pdf
... 5’-CCTGGAGAAATCGATCATGAGCTTCGCTCAGTCGTG-3’ 5’-CACGACTGAGCGAAGCTCATGATCGATTTCTCCAGG-3’ 5’-AAAAGGTCGACATCTGGATGGCGACGAAAGACACGATC-3’ 5’-GATCGTGTCTTTCGTCGCCATCCAGATGTCGACCTTTT-3’ D36N-1 5’-CATCCTTCCCTATCTCAACATCCAGCTGGTTTACT-3’ ... 5’-CATCCTTCCCTATCTCAACATCCAGCTGGTTTACT-3’ D341N-1 5’-AAGGGGAGAACTCAACGGAACACCGGAGG-3’ 5’-CACTCTCGAAGAGTTCATAAACGAAGTGAAGAAGAATCTC-3’ 5’-GAGATTCTTCTTCACTTCGTTTATGAACTCTTCGAGAGTG-3’ F205M D36N ... oxygen of Asp270 and Asp247¢ represented the equatorial ligands, whereas Asp270 and Asp274 were the axial ligands Cofactor binding The b-decarboxylating dehydrogenases share a unique cofactor-binding...
- 18
- 410
- 0
Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?
... Advertising leaflets can not create the trust for customers The customers usually receive the leaflets after that they throw away or if they read it but they can’t remember information of the suppliers ... many times a day so they can easily recognize brand name of the suppliers The customers are very impressed by the images that the suppliers advertised in the television It’s look lively, real, ... TOPIC 13 By what means can a product or a servicebe advertised? Briefly present the strengths and weaknesses of each means A product or a service can be advertised by many means such as: Television,...
- 20
- 862
- 0
báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx
... defects of cleft lip and palate as well as any craniofacial anomaly, Class II and Class III buccal occlusions, and hypodontia Only the highest scoring trait is used to assess treatment need [29] Thereafter, ... treatment status Page of (page number not for citation purposes) Health and Quality of Life Outcomes 2008, 6:64 ily related to the participant's oral impact In other words, occlusal traits that ... that affect dental appearance and have an impact on participants' daily lives may not be captured by IOTN In addition, DAI has many more measures of malocclusion affecting the anterior teeth than...
- 6
- 594
- 0
Báo cáo toán học: "The characteristic polynomial of a graph is reconstructible from the characteristic polynomials of its vertex-deleted subgraphs and their complements" doc
... subgraph and its complement This is crucial to the proof of Theorem 3.1 Finally, the referee noted that the result from the title can be reformulated as follows: The eigenvalues and main angles of ... and S Simi´, Eigenspaces of graphs Encyclopedia of c c Mathematics and its Applications, 66 Cambridge University Press, Cambridge, 1997 [4] N Deo, F Harary and A. J Schwenk, An Eigenvector Characterization ... Lemma 2.3 to prove that the characteristic polynomial is also reconstructible But there is an alternative argument to this Let PG (x) be the derivative of the characteristic polynomial of G Then...
- 9
- 363
- 0
Báo cáo toán học: "The polynomial part of a restricted partition function related to the Frobenius problem" pptx
... formula for PA (t) in [I] Let us define QA (t) by pA (t) = PA (t) + QA (t) From the partial fraction expansion above, it is clear that QA (and hence also pA ) is a quasi-polynomial, that is, an expression ... denote by PA (t) and call the polynomial part of pA (t) It is easy to see that PA (t) is a polynomial of degree n − (More generally, the degree of PA,λ(t) is one less than the number of values of ... Israilov, Numbers of solutions of linear Diophantine equations and their applications in the theory of invariant cubature formulas, Sibirsk Mat Zh 22 (1981), no 2, 121–136, 237 English translation:...
- 5
- 326
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25