the machinery of the brain metaphor is a useful beginning
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... glycosylated at position Taken together, these data identified the glycan as a- D-Gal-(1fi3 )a- D-GalNAc There are several NOEs between the glycan and the glycopeptide side-chain atoms of tx 5a, which ... b-D-Gal-(1fi3) -a- D-GalNAc containing glycopeptide, and native tx 5a were simultaneously incubated and reacted with the same vial of the enzyme b-galactosidase Native tx 5a, tx 5a hydrophilic, and tx 5a ... heteronuclear two-dimensional NMR spectroscopy The data clearly indicated that the tx 5a glycan is in an a- D-Gal-(1fi3) -a- D-GalNAc configuration Taken together, these data demonstrate that two Conus glycopeptides...
- 11
- 563
- 0
the nothing that is, a natural history of zero - robert kaplan
... Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that's 1031), and so through the alluring samaptalambha (1037) and ... estimate wasn't all that bad This is a spectacular application of the Greek insight that the world afar can be grasped by analogy to the world at hand But it is made much more spectacular when ... with Aristarchus' observations and calculations to come up with an imaginary sphere (call it S) whose radius is the distance from the earth to the sun; then he assumes that the diameter of the earth...
- 238
- 5,165
- 0
Báo cáo hóa học: " The temperature arrested intermediate of virus-cell fusion is a functional step in HIV infection" ppt
... in a plate reader Analysis was done in the context of a 96 well plate and the cells were infected with a 2-fold dilution series of HIV to demonstrate that the Magi +/+ assay was in the linear ... is reactive, are not exposed until after TAS has been established Discussion The fusion of the HIV membrane with that of a target cell is a complicated multistep process requiring a variety of ... the virion membrane When the virion and cell membrane merge, the viral membrane label is free to diffuse in the cell membrane In this assay, fusion is scored by a loss of membrane This approach...
- 7
- 334
- 0
Báo cáo sinh học : " The importance of mathematics in biology is a matter of perennial debate" pot
... complex a system as a developing embryo, then facts - and indeed understanding - at many levels must be fed into the mathematics Nor should the value of facts and understanding on their own be dismissed ... played a crucial part, and who are alleged to have referred to their nearby colleagues at Woods Hole as biologists 'who don't count' In any event, if mathematics must be applied to make sense of the ... dismissed The case for Darwin's theory of evolution by natural selection would have been strengthened had he been mathematician enough to recognize Mendelian ratios, but this scarcely diminishes his...
- 2
- 352
- 0
Báo cáo y học: "The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products" potx
... PS and associated proteins are major targets of autoantibodies in SLE [8], cells stimulated via the P2X7 receptor may be a significant source of autoantigen in this disease An allelic variation ... experiments and drafting of the manuscript All authors read and approved the final manuscript Acknowledgements This work was supported by the Medical Research Council of Great Britain The authors ... induces a form of cell death known as aponecrosis, which exhibits several characteristics of apoptosis We therefore suggest that the P2X7 receptor and gene have the functional and positional characteristics...
- 8
- 429
- 0
Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx
... TCAGCCATGTGCTATGTGAAAGATGGCAGGCTTAAAAAAAT rat T-AGCCATGTGCTGTCTGAAGGATGGCAG-GCTTAAAAAAT dog TCAGCCATGTGCTGTGTGAAAGATGGCAGGCT-TAAAAAAT fugu TTAGCCATGT CATGATAAAGATAGCAC-CTATATTTGAT TTAGCTGTGT CATGATAAAGATAGCAC-CTATATTTGAT ... TGGTTCAGCCAGACTCTCTGACTCAGATACACTAAGGGGT TGGCTCAGCCAGACTCTCTGGCTCACATACACTAACTGGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGGTTCAGC-AGACACTCTGGGTGATCTTTATTGAGTGAT ... CATGATAAAGATAGCAC-CTATATTTGAT tetr danio TTAATCTGGTGCTTTGTGCAGTAAAACAG-TTCTACAGAAT refereed research fugu deposited research 5‘ SCE Rat Dog reports (b) Human reviews fugu 5‘ Figure Examples of loci...
- 19
- 510
- 0
Nano product preview march 2009 the applause “ this is a fantastic effort”
... Acetoacetic Ester Acetoacetic Ester O H3C O C C H C OCH2CH3 H Acetoacetic ester is another name for ethyl acetoacetate The "acetoacetic ester synthesis" uses acetoacetic ester as a reactant ... Substituted derivatives of barbituric acid are made Substituted derivatives of barbituric acid are made from alkylated derivatives of diethyl malonate from alkylated derivatives of diethyl malonate O COCH2CH3 ... Alkylation of Ethyl Acetoacetate Alkylation of Ethyl Acetoacetate O H3C C O •• –C C OCH2CH3 H R Dr Wolf's CHM 201 & 202 X The anion of ethyl acetoacetate can be alkylated using an alkyl halide...
- 52
- 1,104
- 0
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx
... Resources A few programs have integrated data systems that enable case managers or care coordinators to track individual families and share data across programs Case managers and care coordinators can ... asthma attack, the gatekeeper [at the hospital] asked me how I knew my baby was having an asthma attack? I shoved him under her nose and said, ‘Blue is not a good color for an African-American baby.’” ... the local system of maternal and child health care The county has model programs of exceptional quality and professional staff and administrators who are dedicated to serving all members of the...
- 79
- 343
- 0
Reserve Recruiting and the College Market - Is a New Educational Benefit Needed doc
... version of the ASVAB (CAT-ASVAB) The sequence of questions asked by the CAT-ASVAB depends on prior answers The raw scores from the CATASVAB cannot be directly compared to the pencil-and-paper version ... compare to educational benefits available to civilians and active duty veterans These comparisons are presented in Chapter After synthesizing these descriptive analyses of the significance of the ... Active Guard Reserve AGR Armed Services Vocational Aptitude ASVAB Battery College Assistance Student Head CASH Start Computer Adaptive Test version of CAT-ASVAB the ASVAB Current Population Survey...
- 97
- 270
- 0
Báo cáo y học: "Perforating eyelid injury extending to the brain stem in a 17-year-old woman: a case report" pot
... Bağdatoğlu H, Boyar B, Doğanay M, Cetinalp E, Karadayi A: The nonsurgical management of a penetrating orbitocranial injury reaching the brain stem: case report J Trauma 1994, 36:116-118 Matsuyama T, Okuchi ... by the blunt trauma Page of Discussion This case demonstrates that examination of a superficial injury and descriptions of an accident by a patient not necessarily indicate the extent of the ... was altered, indicating minor brain damage After the vitreous hemorrhage had cleared, a retinal break was found superiorly where the intraretinal hemorrhage had been located, and the break was...
- 3
- 263
- 0
Báo cáo y học: "The self-reported Montgomery-Åsberg depression rating scale is a useful evaluative tool in major depressive disorder" potx
... had a history of psychiatric hospitalisation Overall, patients had a mean MADRS of 35.9 and a mean CGI-S of 5.1; 57.6% were rated as severely ill (MADRS ≥ 35) Finally, the evaluative ability of ... of the factor analysis confirmed the unidimensionality of the MADRS-S: each item contributed to the first factor axis with a factor loading of at least 0.50, explaining 45% of the total variance ... performed at baseline and at weeks 1, and after start of treatment Sociodemographics and clinical data were collected at baseline, and the investigators administered the MADRS, the Clinical Global Impression...
- 6
- 519
- 0
Báo cáo khoa học: " Proteomics computational analyses suggest that the bornavirus glycoprotein is a class III viral fusion protein (γ penetrene)" pot
... bornavirus G sequences used in the analyses included ABH03174, CAC70658 (horse), AAL49985 (sheep), ABH03169 (rabbit), ACG59352 (avian - Aratinga solstitialis), and AAA91195 (human) We also made ... respiro rubula Rhabdoviridae G class III F Paramyxoviridae HA TPMV-like class henipa class I I Paramyxovirinae pre class I, II, III Pneumovirinae F HA class class I I Paramyxoviridae avula metapneumo ... of Borna disease virus and persistence Front Biosci 2002, 7:d569-579 Carbone KM, Duchala CS, Griffin JW, Kincaid AL, Narayan O: Pathogenesis of Borna disease in rats: evidence that intraaxonal...
- 10
- 335
- 0
Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"
... Impact of Adjuvant Chemotherapy and Surgical Staging in EarlyStage Ovarian Carcinoma: European Organisation for Research and Treatment of Cancer–Adjuvant ChemoTherapy in Ovarian Neoplasm Trial J Natl ... was encountered, as well as in cases of important hypacusia or neurotoxicity or in patients over 76 years of age Statistical comparison of overall and disease-free survival was based on Kaplan-Meier ... estimates of survival and a log-rank test of statistical significance Results The study population consisted of 122 patients Median age of both the consolidation therapy population and the nihil arm...
- 10
- 420
- 0
Báo cáo khoa học: "Thickness of cumulus cell layer is a significant factor in meiotic competence of buffalo oocytes" potx
... nuclear material was scattered in the ooplasm indicating spindle damage Statistical analysis Data for meiotic development of oocytes among all groups was analyzed by chi square procedure using Statistix ... University of Minnesota, Saint Paul, USA and Dr Muhammad Aleem Bhatti, Associate Professor, Department of Theriogenology, University of Veterinary and Animal Sciences, Lahore, Pakistan for their support ... Suitability of follicular oocytes obtained from slaughtered buffalo ovaries and assessment of their nuclear maturation Buffalo J 1998, 14, 217-227 17 Gupta SP, Nandi S, Ravindaranatha BM, Sharma VP...
- 5
- 370
- 0
Báo cáo y học: "Synovial fluid level of aggrecan ARGS fragments is a more sensitive marker of joint disease than glycosaminoglycan or aggrecan levels: a cross-sectional study" pps
... Michael Pratta and Sanjay Kumar for the generous gift of ADAMTS-4, the mAb OA-1 and KS capture ELISA plates, Maria Hansson for help in the modification of the ARGS ELISA and data acquisition, Jan-Åke ... contributions SL participated in the design of the study, carried out the modification of the ARGS ELISA, the acquisition of data and the analysis and interpretation thereof, and was primarily responsible ... Figure Anti-ARGS western blot of ELISA-captured material Aggrecan fragmaterial ments captured by the anti-keratan sulfate (KS)-coated plates were extracted after a completed ELISA and analyzed...
- 11
- 339
- 0
báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot
... detect the hemi-methylated state of the DNA that occurs after the synthesis of the new DNA strand [50-52] This domain behaves as a “hand” with a palm which holds the methylated cytosine, after that ... Tajima H, Fujita H, Takamura H, Ninomiya I, Fujimura T, Ohta T, Yashiro M, Hirakawa K: Effects of valproic acid on the cell cycle and apoptosis through acetylation of histone and tubulin in a ... cycle arrest, apoptosis and tumor vascularization reduction An open square containing a question mark, emphases the possibility that numerous other natural compounds can take the same pathways leading...
- 10
- 414
- 0
Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx
... inflammatory response, the greater the mortality rate antibiotic therapy Correlation between delta-SOFA and delayed initiation of adequate antibiotic therapy SOFA, Sequential Organ Failure Assessment ... in the hospital, and the dose and pattern of administration were in accordance with current standards Failure of organs was evaluated using the Sequential Organ Failure Assessment (SOFA) scale ... Predictors of 90-day mortality Only 222 patients could be evaluated for 90-day mortality Mortality rate was 25.7% Multivariate analysis of risk factors for 90-day mortality was identical to the analysis...
- 12
- 293
- 0
Báo cáo y học: " KL-6 concentration in pulmonary epithelial lining fluid is a useful prognostic indicator in patients with acute respiratory distress syndrome" ppt
... Ishizaka A, Watanabe M, Yamashita T, Ogawa Y, Koh H, Hasegawa N, Nakamura H, Asano K, Yamaguchi K, Kotani M, Kotani T, Morisaki H, Takeda J, Kobayashi K, Ogawa S: New bronchoscopic microsample probe ... Kondo K, Ueda S, Hirasawa Y, Watanabe K, Takada Y, Hiwada K: Comparative evaluation of sialylated carbohydrate antigens, KL-6, CA19-9 and SLX as serum markers for interstitial pneumonia Respirology ... activity Sialylated carbohydrate antigen KL-6 Chest 1989, 96:68-73 13 Ishizaka A, Matsuda T, Albertine KH, Koh H, Tasaka S, Hasegawa N, Kohno N, Kotani T, Morisaki H, Takeda J, Nakamura M, Fang...
- 7
- 363
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25