the instance name and variable name highlighted with bold rectangles of a text field are different identifiers and must be unique
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... Annals of Mathematics, 163 (2006), 723–741 The number of extensions of a number field with fixed degree and bounded discriminant By Jordan S Ellenberg and Akshay Venkatesh* Abstract We give an ... controlling the 3-class numbers of the quadratic subextensions; this can be done using the results of [6].) In the latter case, we can refine the argument above; let bM (Y ) be the number of quadratic ... techniques are available, they obtain an exponent of the nature c log(n); a proof of this bound can be found in [8, Lemma 2.4] This suggests that replacing nε in (1.1) by a constant will be rather...
- 20
- 478
- 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... from database, performed the sequences analysis and critically revised the manuscript 14 16 18 19 Acknowledgements We are grateful to Natalia Gudiño for the language corrections of the manuscript, ... Podder G, Faruque AS, Matthijnssens J, Zaman K, Breiman RF, Sack DA, Van Ranst M, Azim T: Typing of human rotaviruses: nucleotide mismatches between the VP7 gene and primer are associated with genotyping...
- 4
- 329
- 0
Báo cáo y học: "Testing for the association of the KIAA1109/Tenr/IL2/IL21 gene region with rheumatoid arthritis in a European family-based study" ppt
... criteria for RA [14], according to the rheumatologist in charge of the patient Each family consisted of one RA patient and both parents, with the ethnicity as determined by grandparental origin Characteristics ... from Belgium, nine families from the Netherlands and 14 families from Portugal Families with an additional affected sibling and with RA patients Page of (page number not for citation purposes) Arthritis ... LvdP, AL-V, TB and FC contributed to the recruitment of families and to the acquisition of clinical data All authors read and approved the final manuscript Authors' information The European Consortium...
- 7
- 448
- 0
Báo cáo y học: "Effects of lifestyle physical activity on perceived symptoms and physical function in adults with fibromyalgia: results of a randomized trial" pdf
... LPA on ambulatory reports of physical activity, pain and fatigue, as well as measures of fitness, pain threshold and pain tolerance, we also collected questionnaire-based data on these variables ... 0.498 Taking other medications, N (% )a 33 (87) 44 (96) 0.146 Steps per day *Data for categorical variables are presented as N’ and percentages; data for continuous variables are presented as means ... participated in designing the study and assisted with the drafting of the manuscript All authors read and approved the final manuscript Competing interests Kevin R Fontaine and Lora Conn declare...
- 9
- 381
- 0
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot
... really good at explaining things The lecture ought to start with an introduction to some important area of biology and end with a list of some of the major outstanding problems in that area and ... synthetic organic chemists and so on And he says that biologists are better off because most biologists can go to any talk by any other biologist, whether they are a structural biologist or a ... know what to make of the typical biology seminar, with its lists of gene names and gel slides and acronyms that don’t stand for anything sensible Clifford: Are you saying there should be a computer...
- 2
- 190
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
... Drosophila Dally and Dally-like protein are encoded on the same chromosome, but are far more distantly linked than are the mammalian clusters Glypican proteins are between 555 and 580 amino acids ... particles are critical for the long-range activity of Wnts and Hhs [6,33] In the particular case of Hh, it has been proposed that the glypicans in lipophorins may promote the formation of ligand-receptor ... effects of GPC3 and Dally-like protein on Hh signaling? Equally important will be a detailed characterization of the interaction of glypicans with Hhs, Wnts, and BMPs Some of the questions to be answered...
- 6
- 390
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
... DD|395578 DV|206272 CTGTTGACAGTGTAAGGTGAGCTTTGTTAAATATCTCACAAGCGCA-CGGGCCAACGAACTCGTAAAAGTCTCCGTTAGGCA CGCTTGACACATCAGGGGTGACATTGTTAATTCCATCACAAGCGCAGCGGGCTCCCCA -CAACGAAGTGTT G * ****** * ** ... DD|395578 DV|206272 GGCCAAACAGGTTAAACCCTTAATTCCGTTTGTGTTGGAGGAATAGGTATGCCGACTTATGTTGATCCGTCCAAGTGTGATG -GCCAAGCA -AACCCTTAATTCTGTTTGAGTTGGAGGATAAGGTATGCCGACTTATGTTGATCCGTCCAAGTGCGACG ***** ** ************ ... Fe2+ transporter tTGActtTGAaaaTCAT -36 4.04 tTGAAAATCATaaTCAa -30 5.32 208179 5.01 -55 4.31 -49 4.89 208856 tTGAAAAcaAaaaTCAa Has P-type ATPase/hydrolase domains 4.49 -176 4.25 tTGAcAATGATTTTCtT...
- 27
- 356
- 0
báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx
... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization of ... (IAP), and the bilateral projects between Flanders and Brazil and FWO-CNPq Author details Department of Physics, University of Antwerp, Groenenborgerlaan 171, B2020 Antwerpen, Belgium 2Departamento ... the sequence alignment and drafted the manuscript GAF contributed in analysis of the numerical results All authors read and approved the final manuscript Competing interests The authors declare...
- 10
- 471
- 0
Báo cáo toán học: "Graphs with many copies of a given subgraph" ppt
... for the complete bipartite graph with parts of size s and t; - f |X for the restriction of a map f to a set X Specific notation Suppose that G and H are graphs, and let X be an induced subgraph of ... induction Proofs The proofs of Theorems and are almost identical, so we shall present only the proof of Theorem 2, for it needs more care We deduce Theorem from the following technical statement Theorem ... (H ) belong exactly to the same d vertex classes of R Letting m = p/2r−2 , we may and shall assume that |A| = m Let us define a bipartite graph F with parts A and B = V (G), joining i ∈ A to v...
- 6
- 202
- 0
Báo cáo y học: "Immunohistological assessment of the synovial tissue in small joints in rheumatoid arthritis: validation of a minimally invasive ultrasound-guided synovial biopsy procedure" potx
... of the true sample mean the mean area fraction for the particular tissue marker being examined It can be seen that the analysis of a cumulative area of 2.5 mm2 (randomly selected from all available ... the number of high-power fields examined) and the proximity of this sample mean from the overall determination of area fraction Data represent the mean values of all cases As the number of high-power ... fraction of the total sampling population used to create the area fraction calculation increases), the proximity of the sample mean to the overall mean area fraction is asymptotic The number of HPFs...
- 9
- 430
- 0
Báo cáo y học: "Use of the float-moor-crush approach for subtotal mid-segment collapse of a protruding aorto-ostial vein graft stent: a case report" pps
... Santa Clara, CA, USA) was used to moor the catheter to the stent through a side strut (Figure 2) and further advanced the wire to the peripheral portion of the graft After a new channel was created ... ostium was performed Unfortunately, the engagement was unsuccessful and the procedure was aborted Another conservative approach was proposed and a PCI of the native left main and left circumflex artery ... (NYHA IV) A third attempt to reengage the protruding stent in the vein graft ostium was discussed and planned The protruding part of the aorta was long and pointed towards the aortic valve at an...
- 4
- 235
- 0
Báo cáo y học: "Cough: meeting the needs of a growing field" ppt
... little to with postnasal drip Are our means of diagnosing these conditions adequate? Are our treatments appropriate and genuinely effective? There seems, anecdotally at least, to be a group of chronic ... sensitivity as measured by capsaicin or citric acid challenge Such fundamental research raises the hope of an improved understanding of the cough reflex and its sensitisation and ultimately better target ... the other hand, is a rather different kettle of fish It can arbitrarily be defined as lasting longer than eight weeks but by the time these patients reach the specialist cough centre, they have...
- 2
- 177
- 0
Báo cáo y học: "Hypervascular nodule in a fibrotic liver overloaded with iron: identification of a premalignant area with preserved liver architecture" docx
... vein and the artery CK7 immunostaining However, this area was considered as premalignant based on the following arguments: arterial hypervascularization with isolated arteries in the parenchyma ... charge of the patient C Balabaud wrote the paper P Bioulac-Sage interpreted the liver histology and contributed to the writing All authors read and approved the final manuscript Page 10 of 11 (page ... alternate pathway (rarely observed) Figure 10 Pathways leading to HCC in iron overload: (a) classical pathway; (b) alternate pathway (rarely observed) References 10 11 12 Taouli B, Losada M, Holland...
- 11
- 209
- 0
Tài liệu Address Conversion Functions and The Domain Name System docx
... guessed at the name of a WWW site? Netprog: DNS and The Domain Name System • The domain name system is usually used to translate a host name into an IP address • Domain names comprise a hierarchy ... and Domain Name • The domain name for a host is the sequence of labels that lead from the host (leaf node in the naming tree) to the top of the worldwide naming tree • A domain is a subtree of ... so that names are unique, yet easy to remember Netprog: DNS and DNS Hierarchy edu com org jp rpi albany Netprog: DNS and Host name structure • Each host name is made up of a sequence of labels...
- 37
- 486
- 0
Tài liệu Address Conversion Functions and The Domain Name System Refs doc
... at the name of a WWW site? Netprog: DNS and name lookups The Domain Name System • The domain name system is usually used to translate a host name into an IP address • Domain names comprise a ... name is made up of a sequence of labels separated by periods – Each label can be up to 63 characters – The total name can be at most 255 characters • Examples: – whitehouse.gov – barney .the. purple.dinosaur.com ... hierarchy so that names are unique, yet easy to remember Netprog: DNS and name lookups DNS Hierarchy edu com org jp rpi albany Netprog: DNS and name lookups Host name structure • Each host name...
- 37
- 549
- 0
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"
... to carrier and address-molecules to realize high local concentrations of active substances and is able to circumvent the barriers on the way to a save and efficient transfer of therapeutic and ... are commercially available or are easily to prepare By this means a wide range of dienophilic compounds is available for DARinv In order to obtain reaction times in the range of minutes for the ... phosphine and azide Insofar a formal similarity exists between both the Staudinger-Ligation and the Diels-Alder-Reaction with inverse electron demand (as elucidated in scheme/table 1) As shown, the...
- 10
- 623
- 0
FOCUS ON - phrasal ver bs with the particle off and the adverb right
... that we had to carry him out of the bar carryout n Food that you take from a restaurant and eat in another place is carryout or carryout food Takeout and takeout food are the same as carryout and ... back by the salesman call back p.v When you leave a place or walk away from a person and are then asked to return, you are called back / remembered something after she walked away, and I called ... What happened to Mike? Karen called Sarah, but Sarah was at school Sarah didn't call Karen later What didn't happen to Karen? A supermarket chain gave the food to charity and didn't receive any...
- 21
- 531
- 0
Working with the Fogbow Design and reconfiguration of services and participation in e-Government
... writing gradually steered me towards a double-edged professional career, as a journalist and a librarian But the librarian’s role has changed a great deal in the last thirty years Librarians are responsible ... coordinator of a group of specialist teachers, class 19teachers and others working with computer support on a daily basis A plan of action was worked out at a number of meetings and within the framework ... known as an IT society and attract software companies and workplaces.’29 In January 2001 I was called to the first meeting of a group of fellow politicians and civil servants who had been allocated...
- 182
- 566
- 0
Tài liệu Chapter-21-The Domain Name Service doc
... zones and domains below • NS (Name Server) records describe name servers for a zone • HINFO (Hardware Information) records describe the hardware and software that runs on a particular system • CNAME ... somebody, maybe in a different country, to run a subdomain china.example.org, with name servers beijing.china.example.org and xianggang.china.example.org Because there are different name servers, there ... ; nicknames www ftp IN CNAME IN CNAME A A A A A shanghai shanghai Then, /etc/namedb/china-reverse: ; Definition of zone china.example.org @ IN SOA beijing.china.example.org zhang.china.example.org...
- 21
- 443
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25