the independent t test and the mann whitney u test comparing the means of two unrelated groups
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt
... numbers over the diagrams indicate the position of the corresponding nucleotides relative to the translation start site, and the numbers in parentheses below the diagram show the position of the ... and necrosis, and thus for the prevention of systemic lupus erythematosus [11,12] Recently, we demonstrated that an abrupt elevation of serum DNase I activity occurs within h of the onset of ... exons and 1a, and found that the 5¢-UTR of the transcript from exon has a higher content of stem-loop structure than does that from exon 1a Because stable stem–loop structures are known to cause...
- 12
- 609
- 0
The Gentlemen and the Roughs: The Collision of Two Honor Codes in the American North
... Stoic-Christian gentlemen believed, threatened the strength of the Union Army, and in turn, the future of the whole nation But it’s important to point But it’s important to point out that the above discussion ... reluctant to give up the equality of their honor group, and felt that submitting themselves to their officers – whom they often referred to as the “shoulder-strap gentry” — resulted in a loss of ... being created equal, and each wanted their manhood to be recognized by the other But the gentlemen thought the roughs were brutes, and the roughs thought the gentlemen were effete; neither would acknowledge...
- 14
- 365
- 0
mirrors and reflections- the geometry of finite reflection groups - a. borovik, a. borovik
... left and right but does not change up and down? 36 t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t ... connecting a = x(0) and b = x(1), then the continuous function f (x (t) ) takes the values of opposite sign at the ends of the segment [0, 1] and thus should take the value at some point t0 , < t0 ... illustrating the construction of α + β in the proof of Theorem 1.4.2, and fill in the details of the proof 1.4.5 Prove that if t is a translation through the vector α and s is an orthogonal transformation...
- 104
- 419
- 0
Báo cáo hóa học: " Research Article New Trace Bounds for the Product of Two Matrices and Their Applications in the Algebraic Riccati Equation" potx
... immediately Numerical Examples In this section, firstly, we will give two examples to illustrate that our new trace bounds are better than the recent results Then, to illustrate the application in the ... Inequalities and Applications Therefore, considering the application of the trace bounds, many scholars pay much attention to estimate the trace bounds for the product of two matrices Marshall and ... application in the algebraic Riccati equation of our results Finally, numerical examples have illustrated that our bounds are better than the recent results Acknowledgments The author thanks the referee...
- 18
- 456
- 0
Báo cáo hóa học: "ON THE IDENTITY OF TWO q-DISCRETE PAINLEVÉ EQUATIONS AND THEIR GEOMETRICAL DERIVATION" docx
... explicitly derived the equation at hand from the elementary Miura transformations of D(1) Further, we have clarified these relations from the point of view of Weyl group theory and of rational surfaces ... same equation describes the evolution along the independent variable or among any of the parameters of the equation (the latter evolution being mediated by the Schlesinger transformations) In this ... with logθn = α(−1)n As we have pointed out in [11], the geometry of the transformations of this equation is related to the affine Weyl group D(1) , just as in the case of (2.1) On the identity of...
- 11
- 304
- 0
báo cáo khoa học: "Structure and expression of the maize (Zea mays L.) SUN-domain protein gene family: evidence for the existence of two divergent classes of SUN proteins in plants" pot
... proteins Together, these observations suggest that plant nuclei contain multiple different SUN-domain proteins Models of the Topology of Plant SUN-domain Proteins The two structural classes of plant ... with other proteins embedded in the outer nuclear membrane The configuration depicted in topology model “B” would suggest an opposite set of interactions Given the structure of the NE, the two ... domains (Table Figure 3C) This collection of features defines them structurally, but the central location of the SUN domain is not unique to plants Other, nonplant mid-SUNdomain proteins, largely uncharacterized,...
- 22
- 451
- 0
Báo cáo sinh học: "The power of two experimental designs for detecting linkage between a marker locus and a locus affecting a quantitative character in a segregating population" pptx
... intercrossing experiment and attempted to work out the power of these designs However, because of the varying sizes of each of the nested groups, the numerator of the final test statistic used ... variables Therefore it is difhcult to determine the power of the test directly, contrary to a traditional F -test when the null hypothesis is false However, under the assumption of constant size of sibships, ... then the variation for the quantitative trait can be partitioned into that between and within sibships, while that of within sibships can be further partitioned into variation within and between...
- 13
- 278
- 0
Investigation of the roles of two rac1 effectors phosphatidylinositol 5 kinase 1a and p21 activated kinase 1 in insulin secreting cells
... represent the two major types of diabetes mellitus Although, from the epidemiological point of view, they are two distinct diseases, it is difficult to draw a line between them On the other hand, ... is folded and disulfide bonds are formed to generate the native tertiary structure The structure consists of a C-peptide (35 amino acids) at the center of the proinsulin sequence with A-chain ... disruption of F-actin structure However the active-mutant (V12Rac1) had no effect on both basal and stimulated insulin secretion (66), suggesting an essential but not sufficient role of Rac1 activation...
- 182
- 278
- 0
Tài liệu Đề tài " On the volume of the intersection of two Wiener sausages " ppt
... structure of the Swiss cheese should be the same as before; the local structure should depend on the underlying lattice via the number κ ON THE VOLUME OF THE INTERSECTION OF TWO WIENER SAUSAGES ... ∞, and to use the results in [3] to compute the large deviations of the intersection volume on the torus as t → ∞ for fixed N The wrapping is rather delicate because typically the intersection ... entrance-point at the same central hyperplane, thus leaving unreflected those parts of the path that begin with an entrance-point and end with the next exit-point This is done because the latter cross the...
- 44
- 331
- 0
Báo cáo hóa học: " The role of different methanogen groups evaluated by Real-Time qPCR as high-efficiency bioindicators of wet anaerobic co-digestion of organic waste" ppt
... other hands the produced data shows a clear advantage in the pressure-extrusion respect to turbo-mixing pre-treatment as production rate moreover also the cost of the two pre-treatment plants ... evaluated as the best among various tested quantities for obtaining quantifications within the standard curve range and with acceptable PCR efficiency The 1:5 dilution is sufficient to avoid the ... for substrate and product analysis A profile of the substrates, such as butyrate, propionate, H2 and CO2, could be useful in understanding the microbiologic dynamics and the consequent methanogen...
- 7
- 422
- 0
Báo cáo hóa học: "Research Article The Solution of Two-Point Boundary Value Problem of a Class of Duffing-Type Systems with Non-C1 Perturbation Term" pdf
... of 2.11 if and only if u satisfies the operator equation ∇F u 2.25 The Main Theorems Now, we state and prove the following theorem concerning the solution of problem 2.11 Theorem 3.1 Assume that ... solution of v0 t is just a unique solution of 2.12 and u0 t 2.11 The proof of Theorem 3.1 is completed Now, we assume that there exists a positive integer N such that N − μi < λi t, u < N − μi i 1, ... similar to the results in the present paper The special case of A O and n in problem 3.20 has been studied by Zhou Ting and Huang Wenhua Zhou and Huang adopted the techniques different from this...
- 12
- 198
- 0
Scientific report: "Application of PCR to detect the presence of two genes in the genome of rice AtAOS has been genetically modified" pdf
... against insect and pathogens (BlÐe, 2002) Therefore, AOS is an important regulator that steers the octadecanoid pathway to JA synthesis, thus affecting the synthesis of all JArelated compounds ... pCAMBIA1201/AtAOS2 was contructed by Dr.Eunsun Kim) In this study, a set of PCRs was carried out to detect the hygromycin resistance gene, CaMV35S promoter (the promoter located in front of the AtAOS2 ... gene), and the AtAOS2 gene in the transgenic rice genome The results of PCRs would confirm the appearance of the AtAOS2 gene in the transgenic rice genome MATERIALS AND METHODS 2.1 Extraction of...
- 8
- 406
- 0
báo cáo khoa học: "Helping hands: A cluster randomised trial to evaluate the effectiveness of two different strategies for promoting hand hygiene in hospital nurses" ppsx
... strategies State -of -the- art strategy Extended strategy Education All elements of the state -of -the- art strategy Distribution of educational material/written information (leaflet) about hand hygiene • The ... large numbers of observations and participating wards, the randomisation of wards either to the state -of -the- art strategy or the extended strategy, and the use of unobtrusive observations We anticipate ... implementation strategy for hospital-based nursing Our evaluation of the state -of -the- art strategy will validate the effectiveness of this strategy in Dutch hospital care The evaluation will further...
- 9
- 521
- 0
báo cáo khoa học: "Successful interdisciplinary management of the misdeployment of two self-expanding stents into the internal carotid artery: a case report" pps
... Anaesthesiology and Intensive Care, Klinikum Stuttgart, Stuttgart, Germany 3Department of Cardiovascular Disease, Klinikum Stuttgart, Stuttgart, Germany 4Faculty of Medicine University of Tuebingen, ... excellent reconstruction of the proximal carotid artery lumen after six months communicating artery were widely patent and the left external carotid artery contributed to the supply of the left hemisphere ... arteries (V1), a stenosis of the entire left V4 segment and a focal stenosis at the junction of the right V4 segment with the basilar artery The anterior communicating artery and the right posterior...
- 4
- 346
- 0
báo cáo khoa học: " The elicitation of a systemic resistance by Pseudomonas putida BTP1 in tomato involves the stimulation of two lipoxygenase isoforms" potx
... 1(CATGCCATGGGTCACCACCACCACCACGCTATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACAC TATTTGGAAC) - primer (CATGCCATGGCAGC TATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACACTATTT GGAAC) - ... wound-induced JA accumulation, but it drastically reduces the post injury accumulation of protease inhibitors, thereby enhancing the susceptibility of the plants to insect attack [41] The product of TomLoxD ... cucumber, LOX activity is not stimulated by the rhizobacterium, but the activity of enzymes situated downstream the LOX in the pathway is higher in treated plants during the first days of infection [46]...
- 15
- 661
- 0
báo cáo khoa học: "Predictive genetic testing for the identification of high-risk groups: a simulation study on the impact of predictive ability" pot
... and PPV of the test are strongly influenced by the relative magnitude of the size of the high-risk group and the disease risk in the population In addition, selection of high-risk groups with clinically ... high-risk subgroups, these subgroups are defined by choosing cut-off values for the predicted risks The cutoff corresponding to a frequency of the high-risk group equal to the disease frequency optimizes ... values and the percentage of individuals at high-risk to examine the impact of the frequency of the high-risk group on the relationship between the sensitivity, specificity, PPV and NPV Note that...
- 8
- 379
- 0
Báo cáo khoa học: "The Effect of Two Different Oxytetracycline Treatments in Experimental Ehrlichia phagocytophila Infected Lambs" ppt
... 1986) In the present study, rickettsemia was significantly reduced within h after the treatment By PCR analysis of the lambs were found infected days after the antibiotic treatment had started The ... to 1:1280 within 14 days, but no weight reduction was observed None of the other inoculated and antibiotic treated lambs reacted with fever and rickettsemia as a result of cortisone treatment ... treatment, out of lambs had a positive antibody titre, while months later only of these lambs had a positive titre At that time, of these positive lambs and the control lambs had a mean antibody titre...
- 8
- 206
- 0
Báo cáo y học: "learing up the confusion: The results of two pilot studies of antipsychotics for ICU delirium" pps
... suggesting that antipsychotics were safe, at least within these patient populations and within the context of close monitoring for adverse events Unfortunately, both studies were too small to ... rehabilitation Future studies should evaluate the effect of quetiapine on mortality, resource utilization, post-intensive care unit cognition, and dependency after discharge in a broader group of patients ... ziprasidone, and placebo in the treatment of delirium in 101 adult mechanically ventilated medical and surgical ICU patients [1] Twice daily the frequency of study drug administration was adjusted according...
- 3
- 188
- 0
Strategies for the conservation of two critically endangered, endemic primates in panama
... free, and includes teaching Cebus, Alouatta, and Ateles The curriculum includes methmapping and compass use, and the calculation of distances the project offers the students the opportunity to practice ... information about the history of the fauna, native plant knowledge, and the presence and problems related to the primates Training students from the Biology School of the University of Panama This training ... includes topics related to the primates and to the yearly study plan for those communities Measures of the effectiveness of these conservation activities include the continual monitoring and evaluation...
- 10
- 314
- 0
báo cáo hóa học: " Work and diet-related risk factors of cardiovascular diseases: comparison of two occupational groups" doc
... 2Berufsgenossenschaft Nahrungsmittel und Gaststätten, Prevention Department, Mannheim, Germany 3Institute of Nutrition, University of Jena, Germany Authors’ contributions DH and MS carried out the study, participated ... prediction [8] Other risk factors associated with nutrition, include the fatty acids that are a part of the lipids regulating the structure and function of biological membranes [9] Therefore, they ... background GJ contributed to the study design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have...
- 8
- 448
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25