the illustrated egyptian book of the dead a new translation with commentary

Báo cáo khoa học: Structural characterization of the large soluble oligomers of the GTPase effector domain of dynamin potx

Báo cáo khoa học: Structural characterization of the large soluble oligomers of the GTPase effector domain of dynamin potx

Ngày tải lên : 23/03/2014, 11:20
... (Stratagene, La Jolla, CA) using the oligonucleotides I69 7A- f 5Â-GATTAATAATACCAAGGAGTTCGCCTTC TCGG-3Â and I69 7A- r 5Â-CCGAGAAGGCGAACTCC TTGGTATTATTAATC-3Â (Sigma Aldrich). The construct was conrmed ... structural and dynamic characteristics of the individual domains has the potential to throw valuable light on the interac- tions of the individual domains, and the mechanism and variety of the overall ... a saturation at 1% or that the SDS interaction does not disturb the helical characteristics of the chain in the present case. Secondly, the data also imply that the oligomers have helical characteristics...
  • 10
  • 370
  • 0
Báo cáo khoa học: Revisiting the 13C-label distribution of the non-oxidative branch of the pentose phosphate pathway based upon kinetic and genetic evidence doc

Báo cáo khoa học: Revisiting the 13C-label distribution of the non-oxidative branch of the pentose phosphate pathway based upon kinetic and genetic evidence doc

Ngày tải lên : 23/03/2014, 15:21
... can yield different flux patterns. Moreover, the new reaction structure facilitates the estimation of the metabolic fluxes from the 13 C-labe- ling data as the result of a smaller number of parame- ters. ... carbon fragments are retrieved and attached to any suitable acceptor (Fig. 2). As the number of non- oxidative PPP reactions increases, application of the traditional reactions leads to an increase ... minimizes the variance of the sum of squared residuals by dividing the SS res of a model by its degrees of freedom. As the traditional model con- tains more parameters than the half-reaction model, this...
  • 13
  • 443
  • 0
Tài liệu The Egyptian Book of the Dead docx

Tài liệu The Egyptian Book of the Dead docx

Ngày tải lên : 17/01/2014, 06:20
... Egyptian Book of the Dead The Egyptian Book of the Dead 39 Table of Contents The Egyptian Book of the Dead 1 E .A. Wallis Budge 1 The Egyptian Book of the Dead i overthrow ye the enemies of the ... referreth to the placing on the sarcophagus [of Osiris] the arm, the heel, and the thigh of The Egyptian Book of the Dead The Egyptian Book of the Dead 26 [THE CHAPTER OF] MAKING THE TRANSFORMATION ... shall be with them! THE CHAPTER OF THE NEW MOON The Egyptian Book of the Dead The Egyptian Book of the Dead 43 utterly my offences. I have put away utterly all the taints of evil which appertained...
  • 80
  • 621
  • 0
The Filmmaker's Book of the Dead: How to Make Your Own Heart-Racing Horror Movie

The Filmmaker's Book of the Dead: How to Make Your Own Heart-Racing Horror Movie

Ngày tải lên : 15/03/2014, 17:30
... Actipis Jane Dashevsky Amanda Guest Melinda Rankin Jeanne Hansen Jojo Draven & Lucas Pebbles Mami & Papi Takim Albert “Koko” & Siane Soegijopranoto Stefan Soegiarto Loui & Ika ... not all of us are rolling in money, but for the price of a car these days you can make This page intentionally left blank 9THE MECHANICS OF MONSTERS VamPires We’re all familiar with the charming, ... Roger Corman was making the lm THE YOUNG RACERS (1963). At the time, a young Francis Ford Coppola, the multiple Academy Award-winning director who gave us THE GOD- FATHER (1972) and APOCALYPSE...
  • 329
  • 797
  • 0
Tài liệu A Compilation of the Messages and Papers of the President pdf

Tài liệu A Compilation of the Messages and Papers of the President pdf

Ngày tải lên : 18/02/2014, 08:20
... States, and the Seeseeahto, Wofpato, and Wofpakoota bands of the Dakota (or Sioux) Nation of Indians. The accompanying communication from the Secretary of War fully sets forth the considerations ... so large and respectable a number of my fellow-citizens. That a bankrupt law, carefully guarded against fraudulent practices and embracing as far as practicable all classes of society the failure ... distant day. Compilation of the Messages and Papers of the Presidents, A 6 The PRESIDENT OF THE UNITED STATES. SIR: I transmit herewith a treaty concluded with certain bands of the Dahcota Nation...
  • 282
  • 571
  • 0
Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt

Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt

Ngày tải lên : 19/02/2014, 09:20
... States of companies within the meaning of the second paragraph of Article 58 of the Treaty, in respect of the formation of public limited liability companies and the maintenance and alteration ... characteristics of the AIF managed, the governance of the AIFM (including arrangements for the delegation of management services), arrangements for the valuation and safe-keeping of assets and the systems ... another that arise in the course of managing one or more AIF. AIFM shall maintain and operate effective organisational and administrative arrangements with a view to taking all reasonable steps...
  • 54
  • 755
  • 0
Tài liệu Book of Abstracts of the 60th Annual Meeting of the European Association for Animal Production docx

Tài liệu Book of Abstracts of the 60th Annual Meeting of the European Association for Animal Production docx

Ngày tải lên : 22/02/2014, 05:20
... Universitat Autònoma de Barcelona, Bellaterra Joaquim Porcar Subdirecció de Ramaderia, Departament d’Agricultura, Alimentració i Acció Rural, Generalitat de Catalunya, Barcelona Francesc Puchal Academia ... Rural, Generalitat de Catalunya, Barcelona Andrea Urdampilleta Expoaviga, Fira de Barcelona, Barcelona Isabel Vázquez Instituto Nacional de Investigación y Tecnolog a Agraria y Alimentaria, Madrid Representante ... (www.damm.es) Novartis (www.novartis.com) Universitat Politècnica de Catalunya (www.upc.es) Fundació Sagrada Familia (www.sagradafamilia.cat) Institució Catalana d’Estudis Agraris (www.iecat.net) EAAP -...
  • 777
  • 404
  • 0
Tài liệu BOOK OF ABSTRACTS OF THE 63RD ANNUAL MEETING OF THE EUROPEAN FEDERATION OF ANIMAL SCIENCE pptx

Tài liệu BOOK OF ABSTRACTS OF THE 63RD ANNUAL MEETING OF THE EUROPEAN FEDERATION OF ANIMAL SCIENCE pptx

Ngày tải lên : 22/02/2014, 05:20
... dierentiation among three populations of Iranian guardian dogs 6 70 Asgarijafarabadi, G. and Allahyarkhankhorasani, D. Poster Session 10b no. Page Analysis of the origin of sires and dams used ... microsatellite markers 11 13 Jaayid, T .A. and Dragh, M .A. invited invited Book of Abstracts of the 63 rd Annual Meeting of the European Federation of Animal Science Bratislava, Slovakia, 27 - 31 August ... delegate bag The Association EAAP (The European Federation of Animal Science) organises every year an international meeting which attracts between 900 and 1500 people. The main aims of EAAP are to...
  • 476
  • 318
  • 0
Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx

Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx

Ngày tải lên : 06/03/2014, 00:20
... identification of NAD + peak Isolation and mass spectroscopic analysis confirmed the identity of the contaminant. Comparison with the spectrum of an authentic NAD + sample revealed total similarity of ... was entirely due to a large decrease in catalytic efficiency with NAD + rather than an increase with NADP + . In fact, there was a deterioration of  10 fold in the catalytic efficiency with NADP + . Thus ... enzymatic assays, and are displayed in the table. Discrimination factors are calculated as the ratio k cat K m NAD + k cat K m NADP + . Enzyme NAD + NADP + Discrimination factorK m (mM) k cat (s )1 ) k cat ...
  • 9
  • 526
  • 0
A Compilation of the Messages and Papers of the Presidents doc

A Compilation of the Messages and Papers of the Presidents doc

Ngày tải lên : 08/03/2014, 00:20
... Compilation of the Messages and Papers of the Presidents 11 A Compilation of the Messages and Papers of the Presidents The Project Gutenberg EBook of A Compilation of the Messages and Papers of the ... Senate having advised and consented to the ratification of the treaty with the Ottaways, Chippeways, Wyandots, and Pottawattamies concluded at Detroit on the 17th day of November last, and also ... plenipotentiary to negotiate and sign a treaty of peace with Great Britain under the mediation of the Emperor of Russia, to negotiate and sign a treaty of commerce with Great Britain; and the said John...
  • 126
  • 390
  • 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Ngày tải lên : 16/03/2014, 05:20
... blot analysis appeared rather broad, probably because large amounts of unlabeled CFMYP and EGMYP naturally present in the gonads formed broad bands and affected the shape of the bands of the labeled ... phos- phate as a substrate for localization of the labeled MYP. Statistical analysis Data were expressed as the mean ± SEM. Statistical analy- sis was performed using instat software (GraphPad Soft- ware). ... Soft- ware). The normality of the distribution of data was evaluated using the Kolmogorov–Smirnov test. The equal- ity of the standard deviations of the groups was assessed with Bartlett’s test. The...
  • 14
  • 442
  • 0
A Compilation of the Messages and Papers of the Preside pdf

A Compilation of the Messages and Papers of the Preside pdf

Ngày tải lên : 17/03/2014, 02:20
... against the threatened attack. The measure was seasonable and salutary. The Bey had already declared war. His cruisers were out. Two had arrived at Gibraltar. Our commerce in the Mediterranean ... fix the extinction of their title at a breadth of 24 leagues from east to west and about the same length parallel with and including the Wabash. They have also ceded a tract of 4 miles square, ... plenipotentiary to act with others in Europe in negotiating a treaty of peace with Great Britain. Was again elected a Delegate to Congress in 1783, and as a member of that body he advocated and had adopted...
  • 112
  • 412
  • 0
A Compilation of the Messages and Papers of the Presidents Section 2 pot

A Compilation of the Messages and Papers of the Presidents Section 2 pot

Ngày tải lên : 17/03/2014, 02:20
... hand and the seal of the United States of America, at Philadelphia, this 23d day of March, A. D. 1798, and of the Independence of the said States the twenty-second. JOHN ADAMS. A Compilation of ... threatened. JOHN ADAMS. UNITED STATES, April 3, 1798. A Compilation of the Messages and Papers of the Presidents 29 gratitude and mutual congratulations that the malady has disappeared and that we are again ... plundered. A Compilation of the Messages and Papers of the Presidents 18 A Compilation of the Messages and Papers of the Presidents The Project Gutenberg EBook of A Compilation of the Messages and Papers...
  • 74
  • 448
  • 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Ngày tải lên : 17/03/2014, 10:20
... TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA ... Mutation Direction Sequence Standard All Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G ... 2). Association rate constants The kinetics of association of the cystatin A mutants with papain, cathepsin L and cathepsin B were analyzed Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur....
  • 10
  • 533
  • 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

Ngày tải lên : 29/03/2014, 07:20
... agrees to a below-market interest rate in exchange for a share of the appreciated value of the collateral property. The share of the appreciated value is determined and due at the sale of the property ... opinions appear regularly in the Los Angeles Times and the Wall Street Journal. Yago is a recipient of the 2002 Gleitsman Foundation Award of Achievement for social change. He earned a Ph.D. at the ... decide on the appropriate composition of the on- and o-balance-sheet activities allowed by banks to ensure adequate liquidity, capital, and duration match of assets and liabilities. A balance must...
  • 51
  • 467
  • 0