the identity and level of the price index at the balance sheet date and movement in the index during the current and the prior reporting period
An investigation into the reality of teaching and learning speaking skills to the 2nd year non-major english students at pre-intermediate level of proficiency at hanoi university of industry
... DEPARTMENT OF POST GRADUATE STUDIES CANDIDATE’S STATEMENT I certify that the minor thesis entitled: “An investigation into the Reality of Teaching and Learning Speaking Skills to the 2nd year ... Difficult and boring C Interesting and stimulating B Difficult but interesting D Easy and boring What are your difficulties in teaching Speaking skills to the nd year students at PreIntermediate level ... More than periods/ week What you think of the materials used for teaching and learning Speaking to the 2nd year non-major English students at Pre-Intermediate level of Proficiency at your University?...
- 20
- 2,397
- 27
Bringing the Hidden Giants to the Footlight: the Role of Savings and Retail Banks in Increasing the Level of Access to Financial Services docx
... businesses, the traditional target client group of savings banks By capturing and channelling more of the remittances into the financial system and intermediating the flow of the resources, savings ... disbursing of loans and collecting loan repayments Another promising track for savings banks is to invest their savings deposits in microfinance institutions by specialising 18 Microfinance Information ... write-offs of the debts and then refinance the remaining amount at a Microfinance Information eXchange, Inc 17 FEATURE ARTICLES MICROBANKING BULLETIN, ISSUE 15, AUTUMN 2007 lower interest rate GSB...
- 4
- 511
- 0
The States and Moods of Federalism. Governance, Identity and Methodology (French & English) pot
... was greatly involved in the preperation of the mission statement for the authors Finally, we wish to thank the authors for their generous contribution to this project and their patience in the preparation ... by Provincial Government Officials 318 Reception of Visiting Foreign Dignitaries 319 Participation in International Organizations and International Conferences and Negotiations ... XVII THE STATES AND MOODS OF FEDERALISM CHAPTER 11 THE VOICE OF LNDER, REGIONS AND COMMUNITIES IN THE EUROPEAN UNION Rainer Arnold 349 A Supranational Integration and Federalism/Regionalism...
- 498
- 376
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... and with the combination of erythromycin and Esc(1–18) at their sublethal doses (black bars) Aliquots were withdrawn at the time intervals indicated, and plated for counting The percentages of ... as a function of peptide concentration, is shown in Fig 4A Interestingly, there was a dosedependent perturbation of the OM, and the greatest perturbation was obtained at the MIC of the peptide ... stabilization of monolayers at different initial surface pressures (p0), the peptide (0.1–2 lm) was injected into the subphase, and the increment in surface pressure of the LPS film upon intercalation of the...
- 18
- 494
- 0
Báo cáo khoa học: Inhibitors of protein phosphatase 1 and 2A decrease the level of tubulin carboxypeptidase activity associated with microtubules pptx
... Tyr-tubulin to the Glu form [14], total tubulin amount was determined from the CPAtreated sheet Cells were treated at 37 °C with various effector drugs and maintained in an incubator until the time of ... experiments that the effect of the PP1/PP2A inhibitor was to induce redistribution of the enzyme between the microtubuleassociated and nonassociated states rather than to inhibit it Type of phosphatase(s) ... phosphatases, and indicate that PP1 and/ or PP2A are probably the phosphatases involved in regulation of this phenomenon in living cells It remains unclear whether the target of phosphorylation/dephosphorylation...
- 9
- 301
- 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt
... deletion of OXA1 decreased the rate of formation of all aminoglycerophospholipids The rate of PtdSer synthesis decreased to 80%, the rate of PtdEtn formation to 70% and that of PtdCho synthesis ... protein that interacts with the Oxa1p insertion machinery of the IMM [17] Mba1p binds to the large subunit of mitochondrial ribosomes and thereby cooperates with the C-terminal ribosome-binding ... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells were harvested in the mid-log...
- 11
- 354
- 0
university of texas press heraldry for the dead memory identity and the engraved stone plaques of neolithic iberia sep 2008
... transformations occurredin the reuse of sacred objects, the circulation of the remains of the dead, the mimesis of ancestral landscapes, and the rituals that brought the living and dead together in ... to the southern end of the complex The variability in tomb types; the size, location, and visibility of these tombs; the number of individuals buried within them; and the quantity and quality of ... in individuals or groups but is the product of engagement, interaction, and ultimately the social positioning of the self and other (ibid.:586) During the Late Neolithic of the Iberian Peninsula...
- 233
- 221
- 0
báo cáo hóa học: " A comparison of EQ-5D index scores using the UK, US, and Japan preference weights in a Thai sample with type 2 diabetes" pdf
... data, and writing the article RC contributed to analyzing the data and the interpretation of the results RS contributed to analyzing and collecting the data All authors have read and approved the ... clinical data and health status including age, gender, income, duration of diabetes, body mass index (an indicator of obesity), HbA1c level, number of diabetic complications, CES-D scores, and ... Between the UK and US weights, the UK weighted discriminated better for the presence and absence of neuropathy, retinopathy, and cardiovascular complications (the ratios of UK versus US greater...
- 9
- 498
- 1
báo cáo hóa học:" The influence of the level of physical activity and human development in the quality of life in survivors of stroke" potx
... differences in physical activity level and in the quality of life of stroke survivors in two cities differing in economic aspects of the human development index The main findings of the present ... to the maximum value, the better the situation in terms of development The maximum and minimum values are defined through the observation of the world tendencies in terms of indicators for the ... (longevity) and the right to a decent standard of living (income) Regarding education (HDI-E), the indicators are the literacy rate of the population over 15 years and the proportion of people...
- 6
- 509
- 0
Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt
... DNA segments in the absence of ATP (B) The relaxation of supercoils in the presence of topo II and ATP Two supercoils are removed in each enzymatic cycle, resulting in an increase in the DNA extension ... length of the DNA The extension of a confined polymer in the Odijk regime (D ( p) is dominated by the interplay of confinement and intrinsic DNA elasticity The interactions of the polymer with the ... Fig (A) Schematic representation of the buckling instability of dsDNA undergoing topo II- mediated clamping in the absence of ATP Topo II can stabilize the DNA supercoil by binding to the crossover...
- 17
- 351
- 0
Báo cáo y học: "RANKL increases the level of Mcl-1 in osteoclasts and reduces bisphosphonate-induced osteoclast apoptosis in vitro" pps
... 48 hours caused the accumulation of the unprenylated form of the small GTPase Rap1A, thereby demonstrating that ALN inhibits protein prenylation in osteoclasts [2,22] Incubation of osteoclasts ... retraction and alterations in plasma membrane morphology) are consistent with the inhibition of FPP synthase This leads to the inhibition of protein prenylation and the slow accumulation of unprenylated ... hours of cytokine starvation, although the levels of Bcl-1 and Bcl-xL did not Page of (page number not for citation purposes) change during this time (Figure 4b) The loss of Mcl-1 that occurred in...
- 9
- 497
- 0
báo cáo khoa học: "A comparison of the level of enzyme polymorphism in cosmopolitan Drosophila species between populations collected in distilleries and in their surroundings in Hungary" ppt
... locus in populations from the types of micro-habitats It would also be interesting, however, to study the difference in the genetic diversity of the kinds of populations In the case of laboratory ... that were mainly found in populations of region 111 Discussion We compared the level of polymorphism in populations originating from distilleries to those collected in villages in the case of ... number of alleles (each investigated allele taken into account) and average heterozygosity - indicate a higher level of polymorphism in the field as compared with the distillery populations at of the...
- 11
- 313
- 0
Báo cáo khoa hoc:" No connection between the level of exposition to statins in the population and the incidence/ mortality of acute myocardial infarction: An ecological study based on Sweden’s municipalities" pptx
... following order, deprivation index, antidiabetic drugs, statin utilisation, x- and y-coordinates The multivariate model was used in analysing AMI-incidence vs statin utilisation In order to minimise ... representing the change in statin utilisation and the change in AMI mortality were plotted against each other The utilisation of statins, AMI-mortality, AMI-incidence and coronary revascularisation rates ... Inhabitants and Day (TID) [7] The DDD for simvastatin was 15 mg, atorvastatin 10 mg and pravastatin 20 mg The DDD for antidiabetic drugs included both insulin and oral drugs The number of deaths...
- 8
- 478
- 0
Báo cáo y học: "The likelihood of persistent arthritis increases with the level of anti-citrullinated peptide antibody and immunoglobulin M rheumatoid factor: a longitudinal study of 376 patients with very early undifferentiated arthritis" doc
... analysis and interpretation of data and helped draft the manuscript TU helped to draft the manuscript and participated in the data collection AJH, HN and KH participated in the study design and data ... area under the curve (AUC) of 0.69 The combination of slightly increased accuracy and positive likelihood ratios remaining above suggested some gain in informative value of lowering the threshold ... sedimentation rate (ESR) and C-reactive protein levels were determined locally at the participating centres Serum was frozen at baseline and stored at -70°C and used to analyse anti-citrullinated protein...
- 9
- 259
- 0
Báo cáo khoa học: "Variation in the Level of Grain Defect Light Flecks and Spots on Cattle Hides" pps
... distribution of the lice population is well known The population increases during the winter, decreases with the shedding of the winter coat in the spring and remains low during the summer (Gojmerac ... 1990) The seasonal variation in the frequency of light flecks and spots show a pattern that can be related to the variation in the lice population during the year The frequency of light flecks and ... collected from the 28 herds in the main group before the start of the lice eradication programme The herds The selection criteria, the prevalence of lice in the herds and the clinical examination procedure...
- 8
- 347
- 0
Báo cáo y học: "Bispectral index versus COMFORT score to determine the level of sedation in paediatric intensive care unit patients: a prospective study" docx
... sufficient in unsedated or only lightly sedated patients in the ICU setting Data from the investigations cited above and our data suggest that the BIS monitor might be useful in the case of moderate ... subjective interpretation and that information about the level of sedation can only be obtained intermittently Deeper levels of sedation are difficult to assess using clinical sedation scores ... repeated measurements in one patient were included in the study [25,27,28] The objective of the present study was to evaluate use of the BIS to monitor levels of sedation in paediatric ICU patients...
- 9
- 420
- 0
Báo cáo khoa học: "The role of body mass index and diabetes in the development of acute organ failure and subsequent mortality in an observational cohor" doc
... all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis The authors have no funding or support References Key messages • In this ... variable in the analysis and could not explain the results even though the infection rate and the duration of mechanical ventilation were not increased in the obese group Studies of critically ill patients ... determine the role of DM in modifying the effect of obesity Materials and methods Study population The Atherosclerosis Risk in Communities (ARIC) study is a prospective, population-based study of the...
- 9
- 501
- 0
Báo cáo y học: "Influence of sequence identity and unique breakpoints on the frequency of intersubtype HIV-1 recombination" pot
... recombination involving synthesis of both the minus and plus strands of retroviral DNA[6-10] However, increasing evidence suggest that the majority of recombination events occur during synthesis of ... products Calculating the frequency of recombination in the multiple cycle dual infection assay To determine the frequency of recombination after multiple rounds of infection and replication in tissue ... GATTTAGGTGACACTATAGATATAATGAGGTAGTCAAACAATTA-3' and 5'-TTTATTCTGCATTTGAGAGT-3' for 115-A, 5'GATTTAGGTGACACTATAGATATAAGGAGGTAGCCAAACAATTA-3' and 5'-TTTATTCTGCATTGGAGAGT-3' for 120-A, and 5'GATTTAGGTGACACTATAGTATATAGAATGGAATAAAACTATAC-3'...
- 17
- 458
- 0
Blogging and collective action the role of collective identity and social networks in engendering change
... trajectory in terms of purpose and nature: that of disseminating information and facilitating exchanges of opinion, leading to unanticipated impact on real life politics and civic participation In the ... participate in activism at all I gathered data on political bloggers’ perception of others and the nature of the collective identity shared with other political bloggers in Singapore; the nature of their ... participants and the ensuing differences in the roles they play 22 in a movement; the role of social ties (informal and formal) and multiplex ties in the recruitment and mobilization of movements, and the...
- 293
- 379
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25