... Bein and colleagues [37] analyzed the impact of RMs on intracranial pressure and cerebral metabolism in patients with acute cerebral injury and respiratory failure, they observed an increase in ... collapse lead to upregulation ofan inflammatory response, with release of cytokines and chemokines and activation of neutrophils and macrophages that produce lung damage [2] Injurious MV can lead ... cytoskeleton via the focal adhesion complex [11] When the basement membrane is strained, adherent epithelial cells must change shape andthe ratio of their surface (plasma membrane) to their volume...
... 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer forthe APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; andthe 3' primer forthe APOPEC3G-UBA2* fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGagcGAAGTTGGCAG-3' ... used forthe U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified from plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; ... construction of all three plasmids was 5'-GCGCGCGCGCCTCGAGACCATGAAGCCTCACTT-3'; The 3' primers used forthe construction ofthe E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the...
... cooled on ice and immediately analyzed Protein concentration was measured with the BioRad Protein Assay (Bio-Rad, Veenendaal, The Netherlands) using BSA asthe standard following the manufacturer's ... 5'-AAGTGCAGAGTTCGATTCTGTACAA-3' Probe: 5'-CGGGTCACTGGGCGTCCACC-3' Reverse: 5'-GAACAACATGCATTCCGAGAAG-3' Forward: 5'-GCGCAGCGCGTTGAA-3' Probe: 5'-AACGAACAGTCATCACCACATCTCATCCAG-3' Reverse: 5'-GGATGGAGCTCGTCCAAGTG-3' ... TRβ1 and TRβ2 in hypothalamusof healthy control (n = 8) and prolonged ill rabbits (n = 6) Data are expressed as mean ± standard deviation scarce Astudy by Arem and colleagues showed that the hypothalamus...
... subunits, disassembly of transmembrane a helices, anda separation in the contact surface of membrane and protein due to the thickening and shrinkage of lipid bilayer Forthe last case, a quantitative ... sucrose, and 0.1 mM EDTA (pH 7.4) Fluorescences of BIPM (A and B) and FITC (C and D) were measured with K+-activated phosphatase (A and C) and Na+-dependent ATPase (B and D) under pressures at 37 ... surfaces of proteins and water, and/ or protein and lipid bilayer: an increase in the thickness ofthe lipid bilayer partially covers the transmembrane proteins and, thus, decreases the water-soluble...
... TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix ... friends and colleagues: Lung, Tuấn, An, Loan, and others for their cares and encouragements in life and work My research trip was co-sponsored by the Wallonia-Brussels International (WBI) andthe Wallonia-Brussels ... maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation effect can also be seen asthe decrease of active time toward the end ofthe dark phases,...
... human keratins) A 'decoy database' was prepared by sequence reversing each entry and appending this database to the forward database Search parameters specified a MS tolerance of 10 ppm (see above) ... recalibration procedure decreases the average absolute precursor mass error several fold and we achieved a final average absolute mass accuracy of 2.6 ppm This enabled a second-pass database search ... times forthe remaining low abundance ions [38] Alternatively, the total mass range can be acquired in several individual mass ranges, again allowing much longer acquisition times forthe mass ranges...
... reasons of temperament and training, I find it natural and exciting to make forays across what many scholars see asan unbridgeable divide between the humanities andthe natural sciences I must admit ... things as religious, mystical, magical, and so forth within larger processes of meaning making and valuation (singularization), we are better able to analyze the contestations over the meaning and ... own and that of others) and how it acquires meaning as it arises in the body and through interaction with others A more dynamic modelof how we articulate our own experience and that of others...
... Tochigi, Japan Authors’ contributions TK, SM, SU and RU diagnosed, investigated, followed-up and managed the patient, and determined the medical significance SM and TK wrote the manuscript TK and NS ... ofthe abdominal wall to the perforation sites, which masked typical symptoms and signs of gastric ulcer perforation [7] We note the similarity between these two cases andthe present case Although ... informed consent was obtained from the patient for publication of this case report and any accompanying images A copy ofthe written consent is available for review by the Editor-in-Chief of...
... reason is that the author has been a part ofthe “natural setting” She has been working in CARE International in Vietnam for one year anda half This case study uses both qualitative and quantitative ... participation in the research The second and more important reason was that sending the questionnaire via email was fast, cheap and easy to reach the target groups and get feed back from them Beside the survey ... Lichtman (2006: 29), which “tend to ask why and how rather than what and how many” was clearly expressed in these questions In short, the author has used several methods of data collection in the study...
... of Banks, Financial Institutions and Corporates worldwide Some of our clients: ■ ABSA ■ Alpha Bank ■ Axa Investment Managers ■ Bank BPH SA ■ Bank of America ■ Bank of China ■ Bank of Kuwait and ... Rabobank ■ Rand Merchant Bank (SA) ■ Rating Agency Malaysia ■ Raiffeisen International and RZB ■ Saudi Arabian Monetary Agency ■ Shell ■ Société Générale ■ Standard Chartered Group ■ State Bank ... following areas: Credit Analysis ■ Accounting concepts and developments ■ Corporate credit analysis ■ Credit portfolio risk management ■ Bank and country risk analysis ■ Analysis of non-bank financials...
... during the gait cycle The authors found that the ACL carried loads throughout the stance phase and that these loads peaked early in stance The medial collateral ligament was found to be the structure ... used in clinical gait analysis The present challenge is to devise measures of gait performance based on dynamic simulation output and to make these measures applicable to the treatment of patients ... such an induced acceleration analysis (IAA) may be rotational accelerations at joints or the linear accelerations of points such asthe body's COM Zajac et al [3] importantly noted that the induced...
... terms of percentage of correctly classified frames for each class and accuracy, defined asthe ratio between the number of correctly classified frames andthe total number EURASIP Journal on Advances ... allows us to use large 4-gram language models in a single pass ofthe decoder Other approaches are forced to use a smaller language model in the first pass and rescore with a larger language model ... specially considering the lack of video information in our approach R Amaral et al Table 4: Topic indexation results APP ASR Manual Manual Manual Auto Manual Auto w/o conf Auto w/conf Auto w/conf...
... studiesof science and technology, and between STS and policy-relevant research; a lack of comparative research across disciplines and nations; anda bias toward studying the bigger and harder ... that the substance and insights of STS scholarship are of central concern to humankind STS analysis points to all the ‘higher’ aspects of human endeavor—truth and power and justice and equity and ... various arenas of activism and policy A decade ago, STS was mired in the “science Edward J Hackett, Olga Amsterdamska, Michael Lynch, and Judy Wajcman wars”; today, STS scholars are invited (and...
... In fact, English has become the international language If I master this language I can go to any continent in the world: Asia, Europe, Africa, America and Australia Everywhere people speak English ... against foreign invaders if I am not able to obtain any knowledge, any words on this domain? After French, English is a living language because of its vitality and lucidity Thanks to these characteristics, ... about different subjects because each subject has its own vocabularies The more subjects I read in English the more words I can acquire to express my ideas and thoughts with great ease and satisfaction...
... treatment was 74% In Latin America, the incidence of atypical pneumonia was 21% andthe rate of treatment was 57% In Asia / Africa, the incidence was 20%, the rate of treatment was 10% The diagnostic ... group was statistically higher than that of atypical pneumonia in group (p