0

the hypothalamus pituitary ovarian axis as a model system for the study of serm effects an overview of experimental and clinical studies

Báo cáo khoa học:

Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx

Báo cáo khoa học

... Bein and colleagues [37] analyzed the impact of RMs on intracranial pressure and cerebral metabolism in patients with acute cerebral injury and respiratory failure, they observed an increase in ... collapse lead to upregulation of an inflammatory response, with release of cytokines and chemokines and activation of neutrophils and macrophages that produce lung damage [2] Injurious MV can lead ... cytoskeleton via the focal adhesion complex [11] When the basement membrane is strained, adherent epithelial cells must change shape and the ratio of their surface (plasma membrane) to their volume...
  • 7
  • 287
  • 0
Báo cáo y học:

Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

Báo cáo khoa học

... 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; and the 3' primer for the APOPEC3G-UBA2* fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGagcGAAGTTGGCAG-3' ... used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified from plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; ... construction of all three plasmids was 5'-GCGCGCGCGCCTCGAGACCATGAAGCCTCACTT-3'; The 3' primers used for the construction of the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the...
  • 13
  • 254
  • 0
Báo cáo y học:

Báo cáo y học: " Changes in the central component of the hypothalamus-pituitary-thyroid axis in a rabbit model of prolonged critical illness" ppsx

Báo cáo khoa học

... cooled on ice and immediately analyzed Protein concentration was measured with the BioRad Protein Assay (Bio-Rad, Veenendaal, The Netherlands) using BSA as the standard following the manufacturer's ... 5'-AAGTGCAGAGTTCGATTCTGTACAA-3' Probe: 5'-CGGGTCACTGGGCGTCCACC-3' Reverse: 5'-GAACAACATGCATTCCGAGAAG-3' Forward: 5'-GCGCAGCGCGTTGAA-3' Probe: 5'-AACGAACAGTCATCACCACATCTCATCCAG-3' Reverse: 5'-GGATGGAGCTCGTCCAAGTG-3' ... TRβ1 and TRβ2 in hypothalamus of healthy control (n = 8) and prolonged ill rabbits (n = 6) Data are expressed as mean ± standard deviation scarce A study by Arem and colleagues showed that the hypothalamus...
  • 10
  • 378
  • 0
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf

Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf

Báo cáo khoa học

... subunits, disassembly of transmembrane a helices, and a separation in the contact surface of membrane and protein due to the thickening and shrinkage of lipid bilayer For the last case, a quantitative ... sucrose, and 0.1 mM EDTA (pH 7.4) Fluorescences of BIPM (A and B) and FITC (C and D) were measured with K+-activated phosphatase (A and C) and Na+-dependent ATPase (B and D) under pressures at 37 ... surfaces of proteins and water, and/ or protein and lipid bilayer: an increase in the thickness of the lipid bilayer partially covers the transmembrane proteins and, thus, decreases the water-soluble...
  • 9
  • 432
  • 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

Tổng hợp

... TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix ... friends and colleagues: Lung, Tuấn, An, Loan, and others for their cares and encouragements in life and work My research trip was co-sponsored by the Wallonia-Brussels International (WBI) and the Wallonia-Brussels ... maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases,...
  • 58
  • 262
  • 0
Báo cáo y học:

Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt

Báo cáo khoa học

... human keratins) A 'decoy database' was prepared by sequence reversing each entry and appending this database to the forward database Search parameters specified a MS tolerance of 10 ppm (see above) ... recalibration procedure decreases the average absolute precursor mass error several fold and we achieved a final average absolute mass accuracy of 2.6 ppm This enabled a second-pass database search ... times for the remaining low abundance ions [38] Alternatively, the total mass range can be acquired in several individual mass ranges, again allowing much longer acquisition times for the mass ranges...
  • 15
  • 267
  • 0
princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009

princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009

Cao đẳng - Đại học

... reasons of temperament and training, I find it natural and exciting to make forays across what many scholars see as an unbridgeable divide between the humanities and the natural sciences I must admit ... things as religious, mystical, magical, and so forth within larger processes of meaning making and valuation (singularization), we are better able to analyze the contestations over the meaning and ... own and that of others) and how it acquires meaning as it arises in the body and through interaction with others A more dynamic model of how we articulate our own experience and that of others...
  • 229
  • 1,453
  • 0
báo cáo khoa học:

báo cáo khoa học: " Intestinal adhesion due to previous uterine surgery as a risk factor for delayed diagnosis of uterine rupture: a case report" pot

Báo cáo khoa học

... Tochigi, Japan Authors’ contributions TK, SM, SU and RU diagnosed, investigated, followed-up and managed the patient, and determined the medical significance SM and TK wrote the manuscript TK and NS ... of the abdominal wall to the perforation sites, which masked typical symptoms and signs of gastric ulcer perforation [7] We note the similarity between these two cases and the present case Although ... informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of...
  • 3
  • 328
  • 0
Work environment as a motivating factor for self  improvement of english A case study of projects in cảe internatinal in viet Nam

Work environment as a motivating factor for self improvement of english A case study of projects in cảe internatinal in viet Nam

Tổng hợp

... reason is that the author has been a part of the “natural setting” She has been working in CARE International in Vietnam for one year and a half This case study uses both qualitative and quantitative ... participation in the research The second and more important reason was that sending the questionnaire via email was fast, cheap and easy to reach the target groups and get feed back from them Beside the survey ... Lichtman (2006: 29), which “tend to ask why and how rather than what and how many” was clearly expressed in these questions In short, the author has used several methods of data collection in the study...
  • 11
  • 442
  • 0
Selling Financial Products - A proven methodology for increasing sales of banking and financial services doc

Selling Financial Products - A proven methodology for increasing sales of banking and financial services doc

Tiếp thị - Bán hàng

... of Banks, Financial Institutions and Corporates worldwide Some of our clients: ■ ABSA ■ Alpha Bank ■ Axa Investment Managers ■ Bank BPH SA ■ Bank of America ■ Bank of China ■ Bank of Kuwait and ... Rabobank ■ Rand Merchant Bank (SA) ■ Rating Agency Malaysia ■ Raiffeisen International and RZB ■ Saudi Arabian Monetary Agency ■ Shell ■ Société Générale ■ Standard Chartered Group ■ State Bank ... following areas: Credit Analysis ■ Accounting concepts and developments ■ Corporate credit analysis ■ Credit portfolio risk management ■ Bank and country risk analysis ■ Analysis of non-bank financials...
  • 8
  • 453
  • 1
báo cáo hóa học:

báo cáo hóa học: " Muscle-driven forward dynamic simulations for the study of normal and pathological gait" potx

Hóa học - Dầu khí

... during the gait cycle The authors found that the ACL carried loads throughout the stance phase and that these loads peaked early in stance The medial collateral ligament was found to be the structure ... used in clinical gait analysis The present challenge is to devise measures of gait performance based on dynamic simulation output and to make these measures applicable to the treatment of patients ... such an induced acceleration analysis (IAA) may be rotational accelerations at joints or the linear accelerations of points such as the body's COM Zajac et al [3] importantly noted that the induced...
  • 7
  • 498
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Prototype System for Selective Dissemination of Broadcast News in European Portuguese" potx

Báo cáo khoa học

... terms of percentage of correctly classified frames for each class and accuracy, defined as the ratio between the number of correctly classified frames and the total number EURASIP Journal on Advances ... allows us to use large 4-gram language models in a single pass of the decoder Other approaches are forced to use a smaller language model in the first pass and rescore with a larger language model ... specially considering the lack of video information in our approach R Amaral et al Table 4: Topic indexation results APP ASR Manual Manual Manual Auto Manual Auto w/o conf Auto w/conf Auto w/conf...
  • 11
  • 429
  • 0
the handbook of science and technology studies

the handbook of science and technology studies

Đại cương

... studies of science and technology, and between STS and policy-relevant research; a lack of comparative research across disciplines and nations; and a bias toward studying the bigger and harder ... that the substance and insights of STS scholarship are of central concern to humankind STS analysis points to all the ‘higher’ aspects of human endeavor—truth and power and justice and equity and ... various arenas of activism and policy A decade ago, STS was mired in the “science Edward J Hackett, Olga Amsterdamska, Michael Lynch, and Judy Wajcman wars”; today, STS scholars are invited (and...
  • 1,082
  • 363
  • 0
The reasons for your study of English and the waysyou have been learning it doc

The reasons for your study of English and the waysyou have been learning it doc

Kỹ năng viết tiếng Anh

... In fact, English has become the international language If I master this language I can go to any continent in the world: Asia, Europe, Africa, America and Australia Everywhere people speak English ... against foreign invaders if I am not able to obtain any knowledge, any words on this domain? After French, English is a living language because of its vitality and lucidity Thanks to these characteristics, ... about different subjects because each subject has its own vocabularies The more subjects I read in English the more words I can acquire to express my ideas and thoughts with great ease and satisfaction...
  • 6
  • 546
  • 1
the study of epidemiological characteristics, clinical manifestations of atypical pneumonia caused by bacteria in children

the study of epidemiological characteristics, clinical manifestations of atypical pneumonia caused by bacteria in children

Tiến sĩ

... treatment was 74% In Latin America, the incidence of atypical pneumonia was 21% and the rate of treatment was 57% In Asia / Africa, the incidence was 20%, the rate of treatment was 10% The diagnostic ... group was statistically higher than that of atypical pneumonia in group (p
  • 14
  • 493
  • 0

Xem thêm