0

the first law of thermodynamics is a restatement of the

Tài liệu Chapter XV The First Law of Thermodynamics pdf

Tài liệu Chapter XV The First Law of Thermodynamics pdf

Vật lý

... constantPV)(11)()(2211221121VPVPVPVPRCTTnCWVV120lnVVnRTWQ4/29/2008 2Chapter XV The First Law of Thermodynamics §1. Heat, work and paths of a thermodynamic process§2. The first law of thermodynamics §3. Kinds of thermodynamic processes§4. Thermodynamic processes ... processes for an ideal gas4/29/2008 26Summary The first law of thermodynamics: ΔU = Q - W The change of internal energy The quantity of heat addedto the system The work doneby the system The work ... Calculation of work done during volume changes: A typical example of a thermodynamic system is an amount of gas enclosed in a cylinderwith a movable piston. (Such a system is the central part...
  • 27
  • 597
  • 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học

... oligo-merization domain (i.e. b sheets 7 and 8, the AAAdomain helix and the C-terminal helix). However, the majority of these proteins are likely to be other meioticclade AAA ATPases and have the AAA ... domain helixand the C-terminal helix, but not the b domain. The distinguishing feature of members of the meioticclade of AAA ATPases is the SRH motif, which dif-fers from that of other AAA ATPases ... material is availableonline:Fig. S1. Sequence alignment of the C-terminal regions of Vps4, spastin, katanin and fidgetin from a range of species.This material is available as part of the online articlefrom...
  • 23
  • 490
  • 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học

... Comparini C, Calamassi R, Pazzagli L,Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia andhyphae of Ceratocystis fimbriata f. sp. Platani. ... cerato-platanin domain, and a blastp search always yielded the members of the cera-to-platanin family as the best hits. It is possible thatthey represent an ancestral cerato-platanin memberthat is ... confrontation assays, osmotic stress and starva-tion. Although the TrichoEST database comprisesESTs of several Hypocrea ⁄ Trichoderma species, and the genome database of H. jecorina is available,...
  • 14
  • 494
  • 0
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Chụp ảnh - Quay phim

... situations. To mask some of the noise at low light levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard. Some cameras that automatically ... scene have the same color temperature. A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation. Most cameras can adjust automatically to ... near the subject and pointed toward the camera. The minimum acceptable level for color television depends on the ability of the lens to transmit light to the camera, the sensitivity of the...
  • 6
  • 462
  • 1
Learning english is a piece of cake 1

Learning english is a piece of cake 1

Kỹ năng nói tiếng Anh

... raɪz njuː wɜːdz and grammatical rules. In fact, learning English can be a piece of cake. ənd ɡrə ˈmæt ɪk əl ruːlz ɪn fækt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ kæn biː ə piːs ʌv keɪk Don’t worry about ... worry about pronunciation. Don’t worry about grammar. doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən. doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes. Just try to speak. doʊnt biː ə ... want to improve my English! Many people are worried about learning English. ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ They think English is difficult and it’s hard to memorize new...
  • 2
  • 1,669
  • 15
Shooting the Sacred Cows of Money Putting a bullet in the head of bad financial advice

Shooting the Sacred Cows of Money Putting a bullet in the head of bad financial advice

Quản trị kinh doanh

... Tom is an international speaker and anadjunctprofessorin the Masters of TaxprogramatArizonaStateUniversity.Heservesas the RichDadAdvisorforTaxandWealthStrategyand is the author of anupcomingRichDadAdvisorbookonbuildingwealththroughtaxstrategies. ... industry was born called nancial planners. Today it takes 30 days to become a nancial planner. It still takes a year and a half to become a massage therapist. RobertAndy,whatdoyouthink of mutualfunds?Andy ... my house had appreciated in value. Again, that’s capital gains versus cash ow. And what peoplearendingoutnowthat the realestatemarkethascrashedand the value of homeshasbeensuckedout…nowpeopleareupsidedownontheirhome,andthey’rendingoutit’s a liabilitybecausetheystillhavetopay the bankonthat...
  • 38
  • 492
  • 0
Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

Quản trị kinh doanh

... that there is always a dangerthat the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and thatif the magazine is not to pass away with the ... rightalong," as the English boys at Oxford made an American collegian say in a theme which they imagined forhim in his national parlance; and the man of letters, as an artist, is apt to have ... necessity rather than the ideal of the paragrapher, and that the notoriety the journalists bestow upon him is not the measure of theiracquaintance with his work, far less his meaning. They are good...
  • 21
  • 544
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Báo cáo khoa học

... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGAATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2...
  • 14
  • 517
  • 0
Selecting the best anthropometric variables to characterize a population of healthy elderly persons ppt

Selecting the best anthropometric variables to characterize a population of healthy elderly persons ppt

Sức khỏe người cao tuổi

... es la selección de las variables antropométri-cas más adecuadas para caracterizar poblaciones sanas depersonas mayores. Para ello se han seleccionado aleatoria-mente 1030 de estas personas ... nificant factors (with eigenvaluesgreater than unity) that are capable of explaining 94.5% of the variance and thus most of the infor mation in the original data set. The new “latent” factors are ... Chemistry. Faculty of Sciences. University of Valladolid. Valladolid. Spain.SELECCIÓN DE LAS VARIABLESANTROPOMÉTRICAS MÁS ADECUADASPARA CARACTERIZAR UNA POBLACIÓNDE PERSONAS MAYORES SANASResumenEl...
  • 8
  • 544
  • 0
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

Báo cáo khoa học

... structures of PolIIIs-V and DnaA-I adopt a vari-ant of the so-called type II KH fold [21]. One of theirmajor differences from classical type II KH domains is the absence of the characteristic GXXG ... The actual DNA synthesis is performed by the catalytic a- subunit (PolIIIa), which belongs to the C-family of DNA polymerases [2]. Polymerases of the C-family fall into two major groups, DnaE and ... III andinteraction with the alpha subunit. Nucleic Acids Res35, 2825–2832.20 Abe Y, Jo T, Matsuda Y, Matsunaga C, Katayama T& Ueda T (2007) Structure and function of DnaAN-terminal domains:...
  • 10
  • 419
  • 0
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf

Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf

Báo cáo khoa học

... annulata, Budonosoma granulifera, Cassiopeaxamachana, Condylactys gigantea, Gorgonia ventalina,Lebrunia danae, Palythoa caribaeorum, Physalia phy-salis, Plexaura homomalla, Stichodactyla helianthus ... magnifica Phylum Annelida, Class Polychaeta, SubclassPalpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae,Genus Sabellastarte [14] The ‘tentacle crown’ and the ‘body’ parts of ... the kingdom Methazoa(Phyla: Annelida, Urochordata, Echinodermata, Cnidaria,Mollusca, Artropoda) were collected in the north coast of Havana and classified by Cuban specialists at the NationalInstitute...
  • 16
  • 628
  • 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học

... inverted terminal repeat amplification were:1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGCATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATTTable 1. Primers and probe sets ... CGCTTTCGGAGGTGCTTTCGCAGM1941p65.R: TCAGAGTTCCCTACCGAAGCAGP0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGAM225PO.P: CCGTGGTGCTGATGGGCAAGAAM267PO.R: ACCATGATGCGCAAGGCCATp21WAF1/CIP1Cyclin-dependent ... sequence of CARP was obtained by PCRamplification using mouse cDNA extracted from muscle of a 129SvTer mouse as a template. The primers usedwere 5¢-CACCATGATGGTACTGAGAG-3¢ and 5¢-GAATGTAGCTATGCGAGAGTTC-3¢....
  • 16
  • 428
  • 0
The Fathers of New England A Chronicle of the Puritan Commonwealths doc

The Fathers of New England A Chronicle of the Puritan Commonwealths doc

Khoa học xã hội

... erected a palisaded embankment with four bastions, a housefor the garrison, and a place for a battery; later he leveled the hill on Castle Island in the harbor, and builtthere a similar palisade and ... large part to the mother country.She established councils and committees of trade and plantations, and, by the seizure of New Netherland in1664 and the grant of the Carolinas and the Bahamas ... educate their children; they disapproved of the lax Dutch observance of Sunday and saw in the temptations of the place a menace to the habits and morals of the younger members of the flock, and,...
  • 71
  • 483
  • 0
the influence of corporate culture of vietnamese companies a study of corporation fpt

the influence of corporate culture of vietnamese companies a study of corporation fpt

Sư phạm

... The highest one and also the visible part of the iceberg is artifact. At the surface, they are visible artifacts and observable behaviors – mission statement, architecture, narratives, language, ... evaluation is a bit insufficient. In this thesis, the writer has also proposed a qualitative study of the concept. In the qualitative thesis, organizational culture is a multi-level. It is ... Symbol Language Narrative Ceremonies Behaviors 12 2.2.1.4 Language CC is first created through the use of language in the creation of a shared vision which is articulated in a firm mission...
  • 77
  • 1,357
  • 14

Xem thêm