the first law of thermodynamics is a restatement of the law of conservation of
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... oligo-
merization domain (i.e. b sheets 7 and 8, the AAA
domain helix and the C-terminal helix). However, the
majority of these proteins are likely to be other meiotic
clade AAA ATPases and have the AAA ... domain helix
and the C-terminal helix, but not the b domain.
The distinguishing feature of members of the meiotic
clade of AAA ATPases is the SRH motif, which dif-
fers from that of other AAA ATPases ... material is available
online:
Fig. S1. Sequence alignment of the C-terminal regions
of Vps4, spastin, katanin and fidgetin from a range of
species.
This material is available as part of the online article
from...
- 23
- 490
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
Ngày tải lên :
17/03/2014, 23:20
... S. & Fire, A. (1998) RNA as a target of
double-stranded RNA-mediated genetic interference in Cae-
norhabditis elegans. Proc.NatlAcad.Sci.USA95, 15502–15507.
44. Tabara, H., Grishok, A. & ... indicated by the open arrowhead, and the Ku-70 and -80 proteins are indicated by closed
arrowheads. In addition, the asterisks represent reappearance of the WD proteins after 24 h (upper panel). The ... amplifi-
cation was performed using LA Taq (Takara, Japan) in a
total volume of 50 lL containing 55 pg of competitor. At
this concentration, the band intensity of the amplified
product from the competitor...
- 11
- 628
- 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
Ngày tải lên :
31/03/2014, 01:20
... phosphorylase, causes a large activation of glycogen
synthase but a small stimulation of glycogen synthesis; (c)
that the stimulation of glycogen synthesis by inactivation of
phosphorylase is associated ... with both activation and
translocation of glycogen synthase, and that the former
mechanism alone cannot explain the stimulation of glyco-
gen synthesis. This suggests that translocation of glycogen
synthase ... of the phosphorylase inactivator, we suggest that
additional factors may be involved in translocation of
glycogen synthase and that phosphorylase a itself may be an
important determinant of the...
- 9
- 381
- 0
university of california press a critical history of early rome from prehistory to the first punic war feb 2005
Ngày tải lên :
11/06/2014, 13:04
... some archaeologists as an indication
that cremating people had come into Italy by sea, and that their migration
was part of the larger upheaval which affected the eastern Mediterranean
at the ... integral aspect of the Villanovan Culture of
northern and much of central Italy. Was the widespread practice of crema-
tion during the Final Bronze Age a passing fad, so to speak, adopted and
then ... been able to arrive
at many firm conclusions about the overall character of these languages
and their historical links to one another.
1
Before Latin began to drive the other languages of ancient...
- 421
- 379
- 0
Shooting the Sacred Cows of Money Putting a bullet in the head of bad financial advice
Ngày tải lên :
08/02/2014, 18:12
... Tom is an international speaker and
anadjunctprofessorin the Masters of TaxprogramatArizonaStateUniversity.Heservesas the RichDadAdvisorfor
TaxandWealthStrategyand is the author of anupcomingRichDadAdvisorbookonbuildingwealththroughtax
strategies. ... industry was born called nancial planners. Today it takes 30
days to become a nancial planner. It still takes a year and a half to become a massage therapist.
Robert
Andy,whatdoyouthink of mutualfunds?
Andy ... my house had appreciated in value. Again, that’s capital gains versus cash ow. And what
peoplearendingoutnowthat the realestatemarkethascrashedand the value of homeshasbeensuckedout…now
peopleareupsidedownontheirhome,andthey’rendingoutit’s a liabilitybecausetheystillhavetopay the bankon
that...
- 38
- 492
- 0
Tài liệu Adopting a Rescue Dog - The First Seven Days From Shelter to Home pdf
Ngày tải lên :
16/02/2014, 07:20
... to adopt a
black dog and wanted one a bit more mature as I was in an
apartment. Lissa had been found, initially reunited with her
family, and then they brought her back to the shelter a couple ... thinking about a small
dog. Neither of our adult children have pets and perhaps they
could take the dog while we are in South Africa. at night
I was on the SPCA website for Northern Virginia. And ... eu-
thanized is a “behavior problem”. Most behavior problems can
be prevented by appropriate socialization and training, under the
guidance of a quali ed trainer. is takes a heavy investment of
time,...
- 107
- 326
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
Ngày tải lên :
19/02/2014, 05:20
... AAACTGCAGGATGGCGGACATCTCCCTGGAC
AAACTGCAGAAGCTTGATTTTGAATTCTGT
pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC
GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG
pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC
ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT
pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA
ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG
pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC
ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG
pEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTT
GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT
pEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGA
ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT
pYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACC
ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG
pYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC
ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC
pYESTrp2...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
Ngày tải lên :
20/02/2014, 23:20
... evolutionary analysis of
the DNase I family. The mammalian group formed a
relatively tight cluster, while the snake (E. quadrivirgata,
E. climacophora and A. blomhoffii), amphibian (X. laevis,
Rana catesbeiana, ... quadrivirgata
,
E. climacophora
and
A. blomhoffii
DNases I
Total RNA was isolated from each snake pancreas by the
acid guanidinium thiocyanate/phenol/chloroform method
[24] and any DNA contamination was ... reagent grade and available commercially. The
snakes and Japanese white rabbits were acquired, main-
tained and used in accordance with the Guidelines for the
Care and Use of Laboratory Animals...
- 8
- 500
- 0
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf
Ngày tải lên :
07/03/2014, 02:20
... annulata, Budonosoma granulifera, Cassiopea
xamachana, Condylactys gigantea, Gorgonia ventalina,
Lebrunia danae, Palythoa caribaeorum, Physalia phy-
salis, Plexaura homomalla, Stichodactyla helianthus ... magnifica Phylum Annelida, Class Polychaeta, Subclass
Palpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae,
Genus Sabellastarte [14] The ‘tentacle crown’ and the ‘body’ parts
of ... the kingdom Methazoa
(Phyla: Annelida, Urochordata, Echinodermata, Cnidaria,
Mollusca, Artropoda) were collected in the north coast of
Havana and classified by Cuban specialists at the National
Institute...
- 16
- 628
- 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
Ngày tải lên :
07/03/2014, 15:20
... reason for this phenomenon (namely enzyme
instability) is discussed in greater detail below.
Instability of the mutant enzyme
Further analysis of the kinetic parameters of the G167E
mutant was ... destabilization of the ISP [14].
It seems probable that this is also the case for the G167E
mutant, and that activity is lost owing to the destabilization
of the complex (loss of the ISP) on dilution ... mitochondria. Studies of the mechanism of assembly
of the bc
1
complex suggest that the ISP is one of the last
subunits to be integrated within the membrane-bound
subcomplex [2]. The integration of the...
- 7
- 498
- 0
Báo cáo khoa học: Investigations on the evolutionary conservation of PCSK9 reveal a functionally important protrusion pot
Ngày tải lên :
23/03/2014, 07:20
... proteins in the marine Califor-
nia sea slug (Aplysia californica) and in the freshwater
snail Biomphalaria glabrata. These CRD homologs
were extracted from ESTs from the Aplysia EST
project and the ... 5)
appeared to migrate normally. To study whether the
abnormal migration of the mature forms of R19 4A-
PCSK9 and D20 4A- PCSK9 was due to altered auto-
catalytic cleavage, western blot analyses of ... two mutants were autocat-
alytically cleaved in a normal fashion.
To study whether the abnormal migration of
mature, cleaved R19 4A- PCSK9 and D20 4A- PCSK9
was due to abnormal glycosylation, the sensitivities...
- 13
- 378
- 0
DECONSTRUCTING MORALITY: A DISCOURSE ON THE FIRST ESSAY
Ngày tải lên :
03/06/2014, 16:50
...
UNEGOISTIC
ACT
SA21 // On the Genealogy of Morals, First Essay Castillo / Saw / Paris / Tan / Medina, K
BEGAN AFTER
UTILITARIANISM
MASTER MORALITY
SA21 // On the Genealogy of Morals, First Essay ... WAR BETWEEN
THE RICH AND THE POOR.
SO THE GOOD-CONTRARY POLARITY BECAME
A. K .A. THE MASTERS AND THE SLAVES.
SA21 // On the Genealogy of Morals, First Essay Castillo / Saw / Paris / Tan / Medina, ... Morals, First Essay Castillo / Saw / Paris / Tan / Medina, K
AS A VITAL SOCIAL COMPONENT,
LANGUAGE ADAPTS TO ITS USERS.
SA21 // On the Genealogy of Morals, First Essay Castillo / Saw / Paris...
- 46
- 267
- 0
báo cáo sinh học:" Burnout and training satisfaction of medical residents in Greece: will the European Work Time Directive make a difference?" pot
Ngày tải lên :
18/06/2014, 17:20
... Mariolis A, Mihas C, Alevizos A, Papathanasiou M, Mariolis-Sapsakos T,
Marayiannis K, Koutsilieris M: Evaluation of a clinical attachment in
Primary Health Care as a component of undergraduate ... continuous variables. The choice of meth-
ods for statistical testing of continuous variables was
based on whether the data permitted parametric or non-
parametric analysis. Categorical variables were ... interests.
Authors' contributions
PM and NCK conceived and coordinated the study and drafted the paper; PM
carried out the mathematical analysis; AT, DK, NS, NP and ET collected data and
assisted...
- 11
- 380
- 0
báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot
Ngày tải lên :
18/06/2014, 19:20
... transplantation produce quality of life
benefits? A quantitative analysis of literature. Transplantation
1997, 64:1261-1273.
15. Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano ... consist-
encies.
Construct validity
- Factor analysis
The factor analysis with varimax rotation identified a
structure of five factors, which accounts for 46.3% of the
total variance (Table 4). The content of each dimension
was ... interpreted the data,
drafted the manuscript; EJ participated in the design of the
study, collected the data and performed the statistical
analysis BD and VM: participated in the design of the
study,...
- 12
- 520
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2