the exchange rate regime as a tool to advance reform success or failure
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR ... plasmid, pLB65, that harbours a gene coding for the temperate lactococcal bacteriophage TP901-1 integrase [21] The strain was used as the host for site-specific integration in the chromosomal attB...
- 12
- 616
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... for each of the alternatives and choose the most suitable measures for the objectives and conditions of the study. Two factors used to determine these scores are scores for the measures with ... are already in debt because of the loans they took for their initial investment costs. For the local government it is also important to have a quick solution for the issues at the farms as the shrimp farming ... on diseases. Finally, the impact and area of impact are important for the aquaculture, agriculture, industries and other land users. Based on these criteria and the preference ...
- 13
- 487
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
Ngày tải lên :
11/08/2014, 00:23
... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea ... updating information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning ... brainstorming sessions and search in the literature to find the potential causes, then categorize these causes in an Ishikawa diagram The Ishikawa diagram can then be kept by individual learners...
- 3
- 381
- 0
the management of foreign exchange rate regime in a market-oriented economy
Ngày tải lên :
04/12/2014, 08:49
... participate in stipulating the exchange rate, have an official exchange rate (listed by the Government) and an unofficial rate, also known as the parallel exchange rate or black market exchange ... exchange rate The official exchange rate also has several types: the interbank exchange rate, exchange rate of commercial banks, accounting exchange rates 1.2.2.2 Nominal and real exchange rate Nominal ... could be anchored at the same equal rate, shared a common mechanism 1.2 Categories of exchange rate 1.2.1 Definition of exchange rate and exchange rate regime The exchange rate is a comparison...
- 67
- 460
- 1
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx
Ngày tải lên :
12/08/2014, 20:20
... that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses glucose regulation as a single value has methodological advantages ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated ... of at least days and were included in the present study The mean age was 55 years (standard deviation 19 years) and 65% were male Table lists the demographical data and glucose-related measures...
- 6
- 264
- 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
Ngày tải lên :
13/08/2014, 09:21
... Mean (and SEM) of the data of the molecular-biology data set from Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, ... simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and condition effects are given in the table The estimated session factors are all close to the factors ... session factors The ratio approach can be seen as a special case, in which the user assumes that the multiplicative factor is the same for every measurement in a session Therefore, the maximum...
- 8
- 304
- 0
Báo cáo y học: "The Mammalian Phenotype Ontology as a tool for annotating, analyzing and comparing phenotypic information" potx
Ngày tải lên :
14/08/2014, 14:21
... turning cardiovascular system abnormal cardiac development o cardiac development is normal prior to the development of vascular defects abnormal vasculature o abnormal vascular dilation noted at E8.5 ... in vascular apoptosis was observed abnormal aorta morphology o dilation occurred throughout the aorta just distal to the heart and extend to most caudal regions of the E8.5 embryo abnormal artery ... developmental anatomy based on a systematic nomenclature Mech Dev 1998, 74:111-120 Hayamizu TF, Magan M, Corradi JP, Kadin JA, Ringwald M: The Anatomical Dictionary for the Adult Mouse: a tool for annotating...
- 9
- 264
- 0
Báo cáo hóa học: " The Armeo Spring as training tool to improve upper limb functionality in multiple sclerosis: a pilot study" ppt
Ngày tải lên :
19/06/2014, 08:20
... functional capacity was assessed with the TEMPA, [27] the Action Research Arm Test (ARAT; normal score = 57) [28] and the 9HPT [29] For the TEMPA, the median execution time of the unilateral activities ... elbow, in the forearm) orthosis without robotic actuators, a socalled passive system The adjustable mechanical arm allows variable levels of gravity support by means of a Gijbels et al Journal of ... such as the MAL (although not yet fairly applicable in MS as it compares the affected with the nonaffected upper limb, whereas motor symptoms can manifest bilaterally in MS patients) and the FM...
- 8
- 678
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... of the American Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia ... change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able to withstand temperate, moisture and ph changes ... differing rates There was no correlation between populations, or even geographical demographics Sex and age both played a major factor in determining the susceptibility to the disease of the individual...
- 4
- 520
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
Ngày tải lên :
03/04/2013, 21:06
... indicating the eating order of the samples Half of the subjects ate the regular aroma samples first and half ate the heightened aroma samples first The subjects were asked to rate one sample a day at ... scale) A sensory profile of the two snack product samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes ... one they thought was correct (identification) (for more information on the test, see (Thomas-Danguin et al., 200 3a) ) Data analysis Repeated measures analysis of variance was used to test the within-subject...
- 10
- 599
- 1
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx
Ngày tải lên :
07/03/2014, 03:20
... been reported [56] Reduced expression of pro-inflammatory mediators is probably a result of the fact that inflammatory transcription factors such as nuclear factor-kappaB, activator protein-1 and nuclear ... apoptosis-inducing factor (AIF) from mitochondria to the nucleus and activation of a caspase-independent programmed celldeath pathway [35–37] Accordingly, the potent PARP-1 inhibitor, PJ34, administered to rats ... Journal 276 (2009) 36–45 ª 2008 The Authors Journal compilation ª 2008 FEBS F Moroni and A Chiarugi PARP-1 and the ischemic neurovascular unit Astrocyte PARP-1 Neuron Inflammatory mediators AIF PARP-1...
- 10
- 417
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... response to subsequent growth factor stimulation [36] Given the importance of the plasma membrane in linking growth factor receptor activation to the signaling cascade, it is likely that any alteration ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways, ... scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation [14] We have reported...
- 10
- 452
- 0
the community development handbook a tool to build community capacity
Ngày tải lên :
27/05/2014, 07:47
... in the city They developed a set of common goals and measures for success Each organization agreed to measure part of their organizational and agency success based on the poverty reduction measures ... s the facilitator or coordinator who brings together and coordinates the community organizations and resources that are needed to plan and implement a community development initiative; s a partner ... is familiar to us and that we have a part to play in it This handbook has been created by the Labor Market Learning and Development Unit at Human Resources Development Canada to support the understanding...
- 90
- 284
- 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
Ngày tải lên :
20/06/2014, 15:20
... on the technique of factor analysis, which examines the correlations among a set of variables, in order to achieve a set of more general "factors." VARIMAX-factor analysis was repeated rotating ... Factor analysis Factor analysis revealed a Kaiser-Mayer-Olkin value of 0.79, which as a measures for the degree of common variance, indicates that the item-pool seems to be suitable for a factorial ... relevant covariate for any of the five forms of SpR practice • Disease itself has an impact on NoP (and a minor impact on HuP and USP), while the duration of disease has no impact on the forms...
- 11
- 425
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
Ngày tải lên :
20/06/2014, 15:20
... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... statistical cohesive set together rather than existing as separate scales For the same reasons, three domains (physical comfort, technical aspects of care, coordination of care) were combined to ... be added It is also important to evaluate the measure using other psychometric paradigms, for example Rasch analysis or item response theory [28,29] Additional items could also be generated that...
- 8
- 492
- 0
báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc
Ngày tải lên :
20/06/2014, 16:20
... correlated with eight and nine respectively of the 13 ATAQ-IPF domain scores evaluated, as well as with the ATAQ-IPF total score The 6MWD was significantly correlated with five domain scores as ... items (in their domains and in aggregate) to Rasch analysis The retained items–by virtue of fitting the Rasch model, like all items that fit the Rasch model–are guaranteed to have the same measurement ... point for an ATAQIPF domain or total score means the same thing whether a respondent has severely impaired or nearnormal HRQL This linearity that the Rasch model constructs differs from the assumed...
- 9
- 719
- 0
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps
Ngày tải lên :
09/08/2014, 10:21
... H37Ra (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg ... The arthritis severity score for each rat was calculated by adding the scores for each individual paw Measurement of hind paw hyperalgesia and edema The method for measuring hyperalgesia has been ... Statistical Package for the Social Sciences software (SPSS Inc Chicago, IL, USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the...
- 7
- 569
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
Ngày tải lên :
09/08/2014, 18:21
... metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs ... fish and batracians Indeed, they could have been inherited from a common ancestor of the vertebrates, as they can be encountered in primitive orders such as cartilaginous fish [59, 75], salamanders ... However, if the recombination rate is very high, saturated genetic maps would be necessary to have very close markers available each time in order to permit a molecular marker-assisted selection The...
- 11
- 318
- 0