the estrogen paradox and a novel framework for targeting sex specific neurocircuits and behavior
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
Ngày tải lên :
17/03/2014, 22:20
... Table 1: Annotated chunks and relations Annotation formalism The definition of the annotation formalism is the core element of the evaluation process Indeed, the formalism must have a coverage ... presegmented and original format The part of the corpus that has been annotated contains about 20,000 words The annotation tools, that we have developed, use an HTML editor For chunk marking, the annotator ... for each relation the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example...
- 4
- 323
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
Ngày tải lên :
18/02/2014, 02:20
... presents a package that is so appealing as to be coercive and, therefore, reduces choice and manipulates behavior A third view is that marketing assesses the individual's self-interest and makes behavioral ... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management.") ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The...
- 14
- 780
- 0
Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf
Ngày tải lên :
19/02/2014, 02:20
... C, Nardone AM, Columbaro M, Scarano G, Mattioli E, Sabatelli P, et al (2005) Alterations of nuclear envelope and chromatin organization in mandibuloacral dysplasia, a rare form of laminopathy ... the A- type lamins are not purely anchorage sites for the genome but perhaps they are involved in a signalling pathway that is perturbed in diseased cells, falsely changing the cellular status and ... Perez-Rosado A, Sanchez-Aguilera A, Fraga MF, Piris MA & Esteller M (2005) Inactivation of the lamin A ⁄ C gene by CpG island promoter hypermethylation in hematologic malignancies, and its association...
- 8
- 510
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
Ngày tải lên :
23/03/2014, 13:20
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... standard had been confirmed by NMR analysis The standard was further purified by RP-HPLC and stored at )70 °C Materials and methods Enzymatic assays Biological materials Tissue Human skin and placenta ... Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes and 2,...
- 11
- 475
- 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" pptx
Ngày tải lên :
11/08/2014, 05:22
... assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation performance across ... contributions MBG drafted the manuscript CB, TH, HA, TO, AG and SA participated in the design of the study TH performed the statistical analysis All authors read and approved the final manuscript Acknowledgements ... printed materials such as e-mail communications, pocket cards, posters and flyers, and removal of organizational barriers) are the same at all stations The audit feedback program is directed at all...
- 13
- 341
- 0
báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx
Ngày tải lên :
11/08/2014, 12:21
... hsa-mir-9 and genes within the pathway strengthen the hypothesis that miR-9 may indeed be a key regulator over pathway behavior and may serve as a potential therapeutic target for Glioblastoma ... versatility, we can identify targets for sophisticated therapeutics approaches Materials and methods Gene datasets TCGA Data were obtained from The Cancer Genome Atlas (TCGA) database This dataset comprises ... variation analysis To further study the molecular characteristics of this pathway, we made use of the intensive molecular features available through TCGA TCGA avails genetic information for each...
- 26
- 278
- 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" docx
Ngày tải lên :
11/08/2014, 16:21
... assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation performance across ... contributions MBG drafted the manuscript CB, TH, HA, TO, AG and SA participated in the design of the study TH performed the statistical analysis All authors read and approved the final manuscript Acknowledgements ... printed materials such as e-mail communications, pocket cards, posters and flyers, and removal of organizational barriers) are the same at all stations The audit feedback program is directed at all...
- 13
- 588
- 0
A design framework for reactive and time triggered embedded systems via the UML systemc bridge
Ngày tải lên :
11/09/2015, 09:11
... the application model to the architecture/platform model, such that the mapped model can be validated and analyzed And third how to validation and performance analysis for the mapped application ... by having libraries of application and architecture components In addition, it is a quantitative approach for architecture evaluation and design space exploration Therefore, the Y-chart approach ... Roychoudhury for his feedback during the initial stage of my research My senior Yang Shaofa and labmates RamKumar Jayaseelan, Dang Thi Thanh Nga, Pan Yu, Ge Zhiguo, Unmesh Dutta Bordoloi, Raman Balaji,...
- 149
- 1.4K
- 0
A general framework for studying class consciousness and class formation
Ngày tải lên :
01/11/2013, 07:20
... class formation, but rather as a framework for de®ning an agenda of problems for empirical research within class analysis In the multivariate empirical studies of class consciousness and class ... which all of the ®rms of that society are organized and interconnected All capitalist societies will have state apparatuses and private ®rms, and among private ®rms some will be small and some large ... determination'': limitation, selection and transformation Let me ®rst explain limitation and transformation Figure 10.3 illustrates the general abstract relation between limitation and transformation: structures...
- 31
- 500
- 0
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc
Ngày tải lên :
20/02/2014, 19:20
... to be formed In case the source of the reparandum information gave a false alarm, the alternative of not skipping the reparandum is still available For each utterance in the input, the parser ... hypothetical start and end of a reparandum (say from a language model such as (Heeman and Allen, 1997)), extends copies of phrase hypotheses over the reparandum allowing the corrected utterance ... increase the recall of a pre-parser speech identifier by 4.8% Another advantage of giving speech repair information to the parser is that the parser can then include reparanda in its output and a...
- 8
- 486
- 0
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx
Ngày tải lên :
22/02/2014, 10:20
... for the purpose A language generation system using the above rule can now ask the application program whether it is prepared to describe a theme and a theme Admittedly this still presumes that ... instance, we add an element describing what the SUBJECT and PRED are for We could say that the SUBJECT is the t h e m e and the PRED is the theme, using terms from functional grammar [Halliday ... generated Tibia is true of all NL s!/stems that translate from a natural language into some formal representation language For any such system, only a fraction of the possible sentences of the...
- 4
- 501
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
Ngày tải lên :
07/03/2014, 03:20
... revealed the C7¢–C8¢ double bond of linear and monocyclic carotenoids to be an additional novel cleavage site of OsCCD1, leading to geranial and indicating a novel plant route for the formation ... internal standard to each assay prior to extraction The conversion rates were determined by calculating the decrease of substrate peak areas measured at their individual kmax values using the max plot ... Journal 276 (2009) 736–747 Journal compilation ª 2008 FEBS No claim to original German government works 743 A novel route for geranial formation A Ilg et al to the peak area of the internal standard,...
- 12
- 497
- 0
Báo cáo khoa học: "A Descriptive Framework for Translating Speaker''''s Meaning Towards a Dialogue Translation System between Japanese and English" pot
Ngày tải lên :
09/03/2014, 01:20
... that is a modification of the former for dealing with Japanese On the basis of a unification parser developed at ATR (Kogure et al 1988), the grammar has been written and proven capable of analyzing ... utterances such as zero anaphora are compensated for and in some cases multiple analyses are disambiguated (3-3), the surface analysis of (3-2), is analyzed as (4-5) This enables an adequate English ... from the viewpoint of the target language interpersonal relations between the speaker and the hearer and the inconvenience of requested action for the hearer Table SurfaceExpressionsfor Deep OPTATIVE...
- 8
- 329
- 0
Báo cáo khoa học: Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase docx
Ngày tải lên :
30/03/2014, 15:20
... trichloroacetic acid in water was added and the mixtures were incubated at °C for 30 (for protein biosynthesis assays, after the addition of trichloroacetic acid, samples were preincubated for 10 at 80 °C and ... characterized as described previously [19] All other chemicals were purchased from standard commercial sources as analytical grade reagents RNAP assays Fig Chemical structure of GE23077 -A and GE23077-B The ... Selva, unpublished data) The activity found against clinical isolates of M catarrhalis suggests that GE23077 can be considered as a natural template for chemical modifications to extend its antimicrobial...
- 9
- 339
- 0
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
Ngày tải lên :
30/03/2014, 15:20
... scDNA only; lane 2, no mAb; lanes 3–6, Bp53-10.1; lanes 7–10, ICA-9 mAb/p53 tetramer molar ratios: lanes and 7, 0.5; lanes and 8, 1.25; lanes and 9, 2.5; lanes and 10, Control samples loaded ... separation in 1% agarose, DNA was stained with ethidium bromide and the gel was photographed Lanes 2–6, reduced p53; lanes 7–11, oxidized p53; lane 1, scDNA only; lanes and 7, no mAb; lanes and ... scDNA [data calculated from densitometric tracing of the free scDNA bands in (B)] For other details, see Fig 2A Although p53red was capable of binding to scDNA in the presence of either of the mAbs...
- 12
- 265
- 0
Báo cáo khoa học: "A Collaborative Framework for Collecting Thai Unknown Words from the Web" pot
Ngày tải lên :
31/03/2014, 01:20
... languages and another for non-segmenting languages Segmenting languages, such as latin-based languages, use delimiting characters to separate written words Therefore, once the unknown words are ... Unknown-word boundary identication results is composed of an information agent and an unknown-word analyzer The task of the information agent is to collect and extract textual data from Web pages of given ... candidate Most-frequent matching pattern with morphological analysis (freq-morph): Similar the the approach freq but with additional morphological analysis to guarantee that the word boundaries...
- 8
- 321
- 0
a novel method for the synthesis of titania nanotubes using
Ngày tải lên :
05/05/2014, 15:26
... However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared ... is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / Journal of Catalysis 246 ... in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated N2 -UAT and O2 -UAT The TiO2 nanotubes...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
Ngày tải lên :
06/05/2014, 08:55
... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... studying the images indicates that the attached to a shaker and were shaken for about synthesized size nanoparticles are less than 12 h Then, by micropipet extracted 10 μL 100 nm That means the synthesized...
- 12
- 705
- 0
interference calculus a general framework for interference management and network utility optimization
Ngày tải lên :
29/05/2014, 16:52
... graduate students of engineering and applied mathematics, as well as academic and industrial researchers in the eld of wireless communications, networking, control and game theory No particular ... background is needed for reading this book, except for some familiarity with basic concepts from convex analysis and linear algebra A general willingness to carry out detailed mathematical analysis ... strategies are applicable to any kind of convex problem However, standard approaches typically ignore the particular analytical structure of the problem at hand Thus, they are not necessarily a good...
- 250
- 545
- 0
the mit press processing a programming handbook for visual designers and artists sep 2007
Ngày tải lên :
11/06/2014, 16:34
... through draw() In the following example, the variable x is declared as a global variable, meaning it can be assigned and accessed anywhere in the program The value of x increases by each frame, and ... can make programming tedious and can make programs difficult to read Instead of using multiple variable names, we can use arrays An array can store a list of data elements as a single name A for ... thousands of musicians and visual artists who use it as a base for creating audio and visual software The same way graphical user interfaces opened up computing for millions of people, alternative...
- 735
- 7.2K
- 0