the essential quality of a trademark
The essential qualities of a team player 1 pptx
Ngày tải lên :
07/07/2014, 12:20
... The 17 Essential Qualities of a Team Player by John C Maxwell • Adaptable: Blessed are the flexible, for they shall not be bent out of shape • Collaborative: Working together precedes ... Where there’s a will, there’s a win 17 Essential Qualities (cont.) • Enlarging: Adding value to teammates is invaluable • Enthusiastic: Your heart is the source of energy for the team • Intentional: ... What traits of an internal partnership are most important to achieving results? • What are the primary obstacles to effective internal partnerships? • What are the key issues related to achieving...
- 6
- 388
- 0
The essential qualities of a team player 2 potx
Ngày tải lên :
07/07/2014, 12:20
... Governmental entities GSEs Real estate professionals Trade associations Collaboration in Practice • • • • • Specialty lending goals/business plans Homeownership preservation initiatives Employer assisted ... Utilizing secondary market products for long term success More about “Collaborative” Maxwell says: • “Collaboration is multiplication.” • “Cooperation is working together agreeably Collaboration is ... communication • Lack of appropriate follow up • Silos – getting all lines of business to work together simultaneously • Budget • Lack of support staff Survey – Key Issues Related to Achieving Profitable...
- 6
- 460
- 0
The essential qualities of a team player 3 pot
Ngày tải lên :
07/07/2014, 12:20
... Audience referral sources (traditional & non-traditional) Materials designed for use by CRA, CDA & mortgage Objectives provide industry updates, discuss other topics of interest, stimulate ... discuss other topics of interest, stimulate followup “You hit home runs not by chance, but by preparation.” -Roger Maris ...
- 5
- 442
- 0
The Essential Ingredients of a Leadership Development Curriculum
Ngày tải lên :
15/07/2015, 15:46
... Thoughts about Leadership • Successful organizations have strong leaders at every level • Development is part of the management culture • The larger the organization becomes, the more it will need a ... think there are 10 crucial elements that must be contained in every curriculum © CMOE 10 Essential Program Elements Break the Ice Hold Up the Mirror Share a Practical Framework or Model Facilitate ... need a strong and deep “bench” of leaders • Leadership principles are constant • There are many facets of leadership • Leadership is a collection of skills • Strong leadership doesn’t happen overnight...
- 24
- 356
- 0
The impact of development on the export quality of a country an empirical analysis of chinese imports
Ngày tải lên :
12/10/2015, 17:36
... Georgia Armenia Azerbaijan Belarus Kazakhstan Kyrgyzstan Ecuador Grenada Guatemala Guyana Haiti Honduras Jamaica Mexico Nicaragua Panama Paraguay Peru Puerto Rico Moldova El Salvador Russia Surinam ... Antigua and Barbuda New Zealand Papua New Guinea Argentina Solomon Islands Bahamas Samoa Barbados Kiribati Belize Republic of the Marshall Bolivia Islands Brazil Chile Columbia Dominica Costa ... Bangladesh Bhutan Brunei Cambodia Cyprus Hong Kong India Indonesia Iran Iraq Israel Japan Jordan Kuwait Laos Lebanon Macau Malaysia Maldives Mongolia Nepal Oman Pakistan Philippines Qatar Saudi Arabia...
- 30
- 496
- 0
Báo cáo khoa học: "Job stress and job satisfaction of physicians, radiographers, nurses and physicists working in radiotherapy: a multicenter analysis by the DEGRO Quality of Life Work Group" ppt
Ngày tải lên :
09/08/2014, 09:22
... staging and radiotherapy treatment planning of head and neck carcinoma Radiat Oncol 2008, 18(3):29 Sharma N, Neumann D and Macklis R: The impact of functional imaging on radiation medicine Radiat ... satisfaction of cancer care workers within the context of different radiotherapy departments in Germany and Austria Methods and study populations Recruiting of radiotherapy facilities Radiotherapy ... one dimensional scale with nine categorical answers (1: very high job satisfaction to 9: total job dissatisfaction) Data analysis The data analysis was carried out with the programme SPSS™ 14...
- 9
- 536
- 1
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
Ngày tải lên :
14/08/2014, 08:20
... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised the drafting and editing of manuscript All authors reviewed...
- 30
- 369
- 0
Blood on FTA™ Paper: Does Punch Location Affect the Quality of a Forensic DNA Profile?
Ngày tải lên :
24/08/2014, 12:30
... prevent any further degradation In the case of database samples, a physical sample of the offender’s DNA must be kept in the laboratory indefinitely in case a database hit ever occurs and the sample ... calculated by taking the average of all called true alleles across all loci from all samples at each peak location Peaks were called as having peak height imbalance when the ratio was less than the expected ... Box and whisker plot of the peak height ratio data The dark square represents the location of the average peak height ratio for each punch location Table The ANOVA results for the average peak...
- 169
- 383
- 0
The Marketing Strategy of a multinational join stock company.doc
Ngày tải lên :
27/10/2012, 16:51
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... about a multinational join stock company’s product quality or the quality of the maintenance work that its staff have done, but has complained about the late reply and maintenance service of the ... Sanyo (Japanese) These are famous brands in the world market and Vietnamese consumers highly appreciate them A multinational join stock company has never had any complaint about the product quality...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...
- 12
- 740
- 0
Tài liệu THE ESSENTIAL HANDBOOK OF INTERNAL AUDITING pptx
Ngày tải lên :
26/02/2014, 04:20
... made in the Operating and Financial Review and the disclosures made as a result of the Turnbull guidance? What are the advantages and disadvantages of turning the board’s private assessment of effectiveness ... sector, against the backdrop to allegations of sleaze and abuse that was a regular feature of the early 1990s Also the new format of the civil service in the guise of departments, agencies, non-departmental ... systems of importance to the entire welfare of the organization However, there are organizations such as banks and retail companies that make great play of compliance checks and have a need for an audit...
- 301
- 4.8K
- 2
Báo cáo " PRELIMINARY ASSESSMENT AND SIMULATION OF THE WATER QUALITY OF CAU RIVER, BAC NINH PROVINCE BY MATHEMATICAL MODEL " pptx
Ngày tải lên :
05/03/2014, 10:20
... self-purification ability of Cau River 3.2 Modeling water quality of Cau River by QUAL2E The Enhanced Stream Water Quality Model (QUAL2E) is a comprehensive and versatile stream water quality model It can ... the water quality of Cau River hasnt been in heavy pollution status yet, in compare with class B - surface water quality standard But at the craft villages that process agriculture products (Dai ... Brown and Thomas O Barnwell, The enhanced stream water quality models QUAL2E and QUAL2E-UNCAS: Documentation and user manual, EPA, (1987), 189 p Meybeck, M., Chapman, D and Helmer, R [Eds] Global...
- 5
- 433
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
Ngày tải lên :
08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
Ngày tải lên :
08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...
- 9
- 533
- 0