the dynamics of the interaction of a disk and a link

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Ngày tải lên : 16/03/2014, 12:20
... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... the absorbance measured at increasing concentrations of ligand, KD is the dissociation constant, c is the concentration of ligand, biotinylated b-DG(654–750), and Asat and A0 are the absorbances...
  • 15
  • 337
  • 0
Báo cáo hóa học: " Research Article Dynamics of a Rational System of Difference Equations in the Plane" pot

Báo cáo hóa học: " Research Article Dynamics of a Rational System of Difference Equations in the Plane" pot

Ngày tải lên : 21/06/2014, 05:20
... division of xn by the instance, one has that a0 n characteristic polynomial of A Further, by elementary techniques of linear algebra one can also compute them in terms of the eigenvalues of A an approach ... system and the description of the Advances in Difference Equations dynamics in the general case β2 / We finish the paper by describing the dynamics in the particular case where the coefficients and the ... λ2 /λ and λ3 /λ The result is trivial when β2 since the eigenvalues √ √ of A are β1 and ± α2 and fixed points are always associated to one of the eigenvalues ± α2 λ2 − α2 /β2 and y∗ λ and, therefore,...
  • 17
  • 365
  • 0
Báo cáo lâm nghiệp:"An examination of the interaction between climate, soil and leaf area index in a Quercus ilex ecosystem" ppt

Báo cáo lâm nghiệp:"An examination of the interaction between climate, soil and leaf area index in a Quercus ilex ecosystem" ppt

Ngày tải lên : 08/08/2014, 01:21
... between the LAI and both climatic and soil factors; (2) understand how the water and carbon balances behave as a function of water availability and LAI; and (3) define how the balance between LAI and ... 154 C Hoff and S Rambal fall and leaf quantity [33, 43] Important then are the timing of rainfall and drought events, the quantity of rainfall, the storage capacity of the soil and quantity and ... has a dual time step Water and most of the carbon variables are calculated on a daily basis, whereas nitrogen and carbon pools are updated each year The model requires daily climate input data:...
  • 9
  • 486
  • 0
The dynamics of literary representation and interpretation in a multilingual environment  a study of selected malaysian and singaporean novels in english

The dynamics of literary representation and interpretation in a multilingual environment a study of selected malaysian and singaporean novels in english

Ngày tải lên : 16/09/2015, 08:30
... Sulawesis and Minangkabaus from Sumatra They spoke different varieties of Malay Munshi Abdullah in his travel accounts contrasts the ‘pure Malay language’ (Andaya & Andaya 119) spoken in the state ... of the characters The mode of first-person narration on the other hand demands the characteristics of the spoken rather than the written word, where the vocabulary and syntax characteristic of ... School in Seramban And the first Malay College, an English-medium school, was opened in 1905 at Kuala Kangsar, and only Malay children of good birth” (Andaya & Andaya 228) and the brightest...
  • 249
  • 440
  • 0
Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

Ngày tải lên : 16/12/2012, 15:21
... density The structures of the various minima, and their relative energies, allow a detailed comparison of the competitive strengths of each type of interaction, and an identification of any that might ... noncovalent interactions, but the E(2) values of all of them are only around 0.52 kcal mol1 The comparison of the complexes of NMA with CH3SH and CH3SCH3 indicates that the loss of the possibility of an ... U Adhikari and S Scheiner p*(CO) interaction, as many of the other structures Another minimum, 0.2 kcal mol1 higher than the first, adds another pair of charge transfers, both into the SS s* antibonding...
  • 7
  • 450
  • 0
DYNAMICS OF LANDSCAPE PATTERNS AND THEIR IMPACTS ON URBAN THERMAL AND BIOMASS ENVIRONMENTS IN THE kUNMING METROPOLITAN AREA

DYNAMICS OF LANDSCAPE PATTERNS AND THEIR IMPACTS ON URBAN THERMAL AND BIOMASS ENVIRONMENTS IN THE kUNMING METROPOLITAN AREA

Ngày tải lên : 16/10/2015, 11:58
... 30m, the same resolution as the Landsat images The thermal band of the TM image was resampled to 60m, the same as the ETM+ image 33 4.2.3 Land use classification system The selection of the land ... directional landscape analyses along with landscape metrics were first used to characterize landscape patterns Change intensities of the landscape patterns were then calculated for the study area as a ... 1999 As the main passage from China to most of the countries in Southeast Asia, such as Vietnam, Laos, Thailand, and Cambodia, and the traffic hubs of the Mekong regional economic cooperation...
  • 129
  • 531
  • 0
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Ngày tải lên : 16/02/2014, 06:20
... Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside the subregion, ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St Kitts and Nevis, St Lucia, St ... and suppliers; ***Paris Club countries are Australia, Austria, Belgium, Canada, Denmark, Finland, France, Germany, Ireland, Italy, Japan, Netherlands, Norway, Russia, Spain, Sweden, Switzerland,...
  • 35
  • 481
  • 0
Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx

Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx

Ngày tải lên : 16/03/2014, 01:20
... in these areas We also chose to place The activity and stability of the Vibrio AP was measured for each mutation, before and after spinlabeling Furthermore, the activity and stability of the ... activity in the standard assay and EPR spectra of the spin-labeled WT AP were measured after incubation in urea The scaled mobility factor (Ms) was calculated from the central linewidth of the EPR ... spin-label and backbone uctuations Analysing the lineshape of the resulting EPR spectrum of R1 can reveal detailed information about the protein, such as secondary and tertiary structural interactions,...
  • 11
  • 280
  • 0
Dynamics of Sewage Spillage and Storm Water Pollution on Lake Victoria Basin- A Case Study of Kisumu Municipality pdf

Dynamics of Sewage Spillage and Storm Water Pollution on Lake Victoria Basin- A Case Study of Kisumu Municipality pdf

Ngày tải lên : 23/03/2014, 04:20
... cyanabacteria and the spread of aquatic weeds such as water hyacinth (Eichornia Crassipes) Water hyacinth infestation has chocked water ways and landings thereby hindering commercial transportation, ... the water surface The major algae blooming zone on the Kenyan side of the lake is in the Nyanza Gulf that encompasses Kisumu municipality and is mainly dominated by the blue and green algae The ... increase in giardia and cryptosporidium parasites and gramnegative bacteria commonly found in sewage Tab.2 Feacal Coliform Count in Migosi and Manyatta Sewage spills into the lake causes increased...
  • 6
  • 661
  • 0
Báo cáo khoa học: Dynamics of a-synuclein aggregation and inhibition of pore-like oligomer development by b-synuclein doc

Báo cáo khoa học: Dynamics of a-synuclein aggregation and inhibition of pore-like oligomer development by b-synuclein doc

Ngày tải lên : 23/03/2014, 09:21
... simulation and later The theoretical pentameric and hexameric conformations of the a- syn multimers on the membrane are reminiscent of the pore-like appearance of cell-free a- syn aggregates that have ... modeling and molecular dynamics simulations, in combination with biochemical and ultrastructural analysis, that 1870 a- syn can arrange into homodimers that can adopt nonpropagating and propagating ... (Fig 2A and 3A) Fig Molecular modeling of nonpropagating and propagating a- syn aggregates on the membrane (A) a- syn minimal energy nonpropagating dimers (head-to-tail) (B) a- syn conformer at 4.0...
  • 16
  • 284
  • 0
Summary of the PERN Cybersminar Air Pollution and Health Linkages doc

Summary of the PERN Cybersminar Air Pollution and Health Linkages doc

Ngày tải lên : 29/03/2014, 18:20
... flows are only constrained by topographical features, and questioned the actual enforcement of such standards Honaganahali added that the US National Ambient Air Quality Standards (NAAQS) are healthbased ... healthbased standards for criterial pollutants that apply for an airshed as a whole These standards have the health risks factored in them, which basically means that if an airshed is compliant ... burning, and mortality in Chiangmai Puttanna S Honaganahali (Institute for Social and Economic Change, India) stated that, in India, agricultural burns are seasonal events that last from a fortnight...
  • 7
  • 384
  • 0
Báo cáo hóa học: " Spontaneous voltage oscillations and response dynamics of a Hodgkin-Huxley type model of sensory hair cells" ppt

Báo cáo hóa học: " Spontaneous voltage oscillations and response dynamics of a Hodgkin-Huxley type model of sensory hair cells" ppt

Ngày tải lên : 20/06/2014, 23:20
... Equation for a random Gaussian force that was band-limited to 200 Hz and had a standard deviation of σs = pN (b) Sensitivity as a function of the amplitude of the sinusoidal external force Values ... is the maximum permeability of IDRK ; [K]in = 112 mM and [K]ex = mM are intracellular and extracellular K+ concentration; F and R are Faraday and universal gas constants; T = 295.15 K is the ... did not lead to significant quantitative changes in the dynamics of the system The bifurcation analysis of the deterministic model was conducted using the software packages CONTENT and MATCONT [24,...
  • 24
  • 349
  • 0
Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

Ngày tải lên : 21/06/2014, 00:20
... Now, assume that parameters a1 , b1, A1 , g2, A2 , and B2 satisfy the condition (8) and inequality 1.i) of Lemma The proof of Theorem is similar to the proof of Theorem in the regions (ℛ9) and (ℛ10) ... assume that parameters a1 , A1 , g2, A2 , and B2 satisfy the condition (8) and inequality 1.i) of Lemma Then the set I= x, A1 A2 β1 + xA1 B2 β1 B2 α1 − A2 β1 :x≥0 is invariant and contains the equilibrium ... are the stable and unstable manifolds of x Theorem In addition to the hypotheses of part (B) of Theorem 6, suppose that μ >1 and that the eigenspace Eμ associated with μ is not a coordinate axis...
  • 29
  • 241
  • 0
Báo cáo hóa học: " Dynamics of a delayed discrete semi-ratiodependent predator-prey system with Holling type IV functional response" pptx

Báo cáo hóa học: " Dynamics of a delayed discrete semi-ratiodependent predator-prey system with Holling type IV functional response" pptx

Ngày tải lên : 21/06/2014, 03:20
... existence and global attractivity of positive periodic solutions of the system (1.3) We note that the time delay has an effect on the permanence and the global attractivity of periodic solution of system ... (No.2009IM010400-1-39) Authors’ contributions HL carried out the main part of this article, WW corrected the main theorems All authors read and approved the final manuscript Competing interests The authors declare ... and global stability for a predator-prey model with modified LeslieGower and Holling-type II schemes Appl Math Lett 2003, 16(7):1069-1075 Nindjina AF, Aziz-Alaoui MA, Cadivel M: Analysis of a...
  • 19
  • 253
  • 0
Báo cáo hóa học: " Research Article Dynamics of a Predator-Prey System Concerning Biological and Chemical Controls" ppt

Báo cáo hóa học: " Research Article Dynamics of a Predator-Prey System Concerning Biological and Chemical Controls" ppt

Ngày tải lên : 21/06/2014, 07:20
... chemical control That is, p1 p2 They investigated the abundance of complex dynamics of the system 1.3 theoretically and numerically The main purpose of this paper is to investigate the dynamics of ... of the prey and the predator at time t, respectively Usually, K is called the carrying capacity of the prey The constant a is called intrinsic growth rate of the prey The constants e, d are the ... in a stable cycle while the prey x t rapidly decreases to zero On the other hand, if the amount q of releasing species is smaller than qmax , then the prey and the predator can coexist on a stable...
  • 17
  • 334
  • 0
Interaction of EcoRI with noncognate DNA sequences  computational investigation of dynamics of protein  water and DNA conformation

Interaction of EcoRI with noncognate DNA sequences computational investigation of dynamics of protein water and DNA conformation

Ngày tải lên : 09/09/2015, 18:49
... Gopuraja Dharmalingam, Mr Thilak Rajasekaran, Dr Kaushik Raghunathan, Mr Madhu Balasubramanian, Mr Santio Ruban and Mr Vasanthakumar Chandran My friends in the research team Dr Karthik Harve, ... vicissitudes of the graduate school came from my friends at NUS, particularly, Dr Karthiga Nagarajan, Mr Vivek Vasudevan, Dr Satyen Gautam, Mr Sundaramurthy Jayaraman and my friends elsewhere around the ... characterized the intrinsic dynamics of the protein and the dynamics and thermodynamics of water in the hydration layer for EcoRI bound to a noncognate sequence (TAATTC) that differs from the...
  • 204
  • 375
  • 0
Dynamics of a control theory ordering system

Dynamics of a control theory ordering system

Ngày tải lên : 04/10/2015, 17:06
... demand and the order rate respectively This means that the outputs are mathematically determined by the inputs and any mathematical function can be used in theory Along with the demand and the ... well as the environment: a car ahead which brakes, a turning, • Then, he analyses the data he has just observed and acts on the steering wheel and the pedals to change the characteristics of the ... that the expected demand over the lead time is calculated from the latest available value of the expected demand It is assumed to be equal to the expected value of the demand times the number of...
  • 111
  • 240
  • 0
EUROPEAN COMPETITION LAW ANNUAL 2005: The Interaction between Competition Law and Intellectual Property Law doc

EUROPEAN COMPETITION LAW ANNUAL 2005: The Interaction between Competition Law and Intellectual Property Law doc

Ngày tải lên : 16/03/2014, 12:20
... providedas is likelythat alternatives are available By the same token, the controversy about the practicality and the adequate level of a market share threshold for dening the scope of application of ... Complementary Strategies and Complementary Assets, 28 R and D Management 263; Arora A. , Fosfuri A and Gambardella A (2003): Markets for Technology and Corporate Strategy, in Granstrand O., ed., supra ... and forner Director General of the Legal Service and Competition Directorate at the European Commission, Brussels Fels Allan, Dean of the The Australia and New Zealand School of Government (ANZSOG),...
  • 768
  • 844
  • 1
Báo cáo hóa học: " Spatial and temporal dynamics of cellulose degradation and biofilm formation by Caldicellulosiruptor obsidiansis and Clostridium thermocellum" ppt

Báo cáo hóa học: " Spatial and temporal dynamics of cellulose degradation and biofilm formation by Caldicellulosiruptor obsidiansis and Clostridium thermocellum" ppt

Ngày tải lên : 20/06/2014, 23:20
... biofilm formation and cellulose degradation The reason why C obsidiansis cells did not grow into the cellulose at h and earlier might be attributable to the available peripheral substrate at the ... cellulolytic biofilms After the initial attachment phase when the bacteria form inverted colonies and depressions in the substrate, the biofilm maintains a thin and uniform profile (approximately 10 ... emphasize the critical role of biofilm formation in cellulose degradation Hence, a rapid startup of cellulose hydrolysis is theoretically achievable by increasing the number of bacteria attached on the...
  • 10
  • 424
  • 0