the deltainotch somitogenesis mutants

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

Ngày tải lên : 18/02/2014, 11:20

... either does not use these residues for binding or that they are not necessary for binding as the DNA binds sufﬁciently hard to the other DNA binding residues For the WAF1 and MDM2 promoters, the ... the cross indicates the cut-off value used in PREDMUT The limit between the classes was set to the activity value of 25%, because this value was observed to be a natural divider of the data The ... severe mutant At the other end of the spectrum, where we have low energy, there is 75% probability for the mutation to be nonsevere if the energy is 0.125 or lower Thus, on the basis of this...

14
561
0

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate speciﬁcity docx

Ngày tải lên : 19/02/2014, 02:20

... for the chemotherapeutic treatment of cancer and viral diseases because they catalyse the addition of the ﬁrst phosphate group to the nucleoside analogue This primes the nucleoside for further ... functional group, the dramatically decreased catalytic rate is most likely due to the increased distance between the catalytic base and the 5¢-OH of either dThd or dCyd These results favour the reaction-mechanistic ... not show any activity must therefore be a consequence of the reactivity of the functional group and further support the hypothesis that E52 acts as an initiating base in the reaction R105 mutations...

10
504
0

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Ngày tải lên : 19/02/2014, 12:20

... [15,29] The yeast mutants with deletions for the genes encoding subunit (VZ1) or subunit (LLD9) failed to grow on the nonfermentable YPEG medium Among the double deletion mutants, the strain with the ... single deletion mutants The values represent the percentages of the amounts of the individual subunits present in the yeast mutant strains with respect to the amounts present in the wild-type strain ... in the inner mitochondrial membrane or lack of detection of the truncated protein by the antibodies In the W303–1B q° strain the amounts of the other two catalytic subunits, cytochrome c1 and the...

10
517
0

Tài liệu Báo cáo khoa học: The calcium-induced switch in the troponin complex probed by ﬂuorescent mutants of troponin I doc

Ngày tải lên : 20/02/2014, 11:20

... experiments, the error bars show the respective SD Lines are the best fit for the equations presented in Table Identification of the TnC domain perceived by the TnI mutants To determine whether the observed ... site II modifies the first part of the signal This indicates that the high affinity Ca2+ signal is related to the N-domain Further, the disruption of the sites in the C-domain affects the lower affinity ... TnC Also, the N-domain was linked to the first part of the bimodal Ca2+ titration curves of the binary complexes Together, these could be evidence that the high affinity sites are in the N-domain...

8
504
0

Tài liệu Báo cáo khoa học: The kinetic properties of various R258 mutants of deacetoxycephalosporin C synthase doc

Ngày tải lên : 20/02/2014, 23:20

... in the apparent Km values for these substrates The interpretation of these results is complicated because the levels of uncoupling will be variable depending on the mutant and the nature of the ... be similar regardless of whether the prime substrate was penicillin G or ampicillin Utilization of 2-oxoglutarate by the R258 mutants The level of 2-OG conversion in the presence of a penicillin ... concentrations and the response also depends on the antibiotic potency of the cephem product [23] Thus, the results from the holed-plate assay should be interpreted with care The effect of mutations...

7
412
0

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

Ngày tải lên : 22/02/2014, 04:20

... pmol for the Tyr183Phe and Asp125Asn mutants, respectively At these protein concentrations, there is a reasonable linear relationship between the absorbance and the enzyme activity The second ... and the Tyr183 hydroxyl group, and between its amide nitrogen atom and Asp125 In the mutants, the hydrogen bond of the amide nitrogen with the Asp125 side chain is not possible anymore, and the ... of the N-acetyl group In the double mutants, the N-acetyl group points away from the C1 atom, and its hydrogen bonding interactions are lost In addition, in the Asp125Ala/ Tyr183Phe mutant, the...

9
616
0

Báo cáo khoa học: Assignment of the [4Fe-4S] clusters of Ech hydrogenase from Methanosarcina barkeri to individual subunits via the characterization of site-directed mutants pdf

Ngày tải lên : 07/03/2014, 21:20

... general the purity of the enzyme from these mutants was lower than the enzyme isolated from the EchF2, EchF6 and EchF8 mutants Hydrogenase activity of the purified enzymes was determined by the H2-uptake ... EchF7 mutants also contained the g ¼ 1.89 signal, however, at lower spin intensities The formation of the g ¼ 1.89 and the g ¼ 1.92 clusters was not dependent on whether the mutation was in the ... detectable in the enzymes from the EchF1, EchF3 and EchF6 mutants The specific activities of the purified enzymes generally correlate with the activities observed in cell extracts An exception is the EchF6...

13
284
0

Báo cáo khoa học: Transport of taurocholate by mutants of negatively charged amino acids, cysteines, and threonines of the rat liver sodium-dependent taurocholate cotransporting polypeptide Ntcp docx

Ngày tải lên : 17/03/2014, 09:20

... whether the wild-type and the mutant proteins are expressed and located on the surface of the oocytes, the cDNA was extended at the 3¢ end by the sequence GATTACAAGGATGACGACGATAAG coding for the ... mutagenesis The three cysteines from the nontransmembrane domains and the one from the C-terminus were substituted by alanine or were omitted to attain deletion mutants All deletion mutants, namely ... space-holding properties of these cysteines tested by deletion mutants and lipophilic binding properties other than by SH-groups tested by tryptophane The deletion mutants of the cysteines from loops...

11
367
0

Báo cáo khoa học: Alterations in the photoactivation pathway of rhodopsin mutants associated with retinitis pigmentosa potx

Ngày tải lên : 22/03/2014, 16:20

... by synthetic DNA duplexes containing the required codon changes in the case of the mutants at position 51 For the mutants at position 89, the restriction fragment replaced was BglII-NcoI The mutant ... lack of the opsinobligatory interaction K296 (7.43) in the latter In the context of the crystal structures (Fig 5), the G51V mutation changes the environment of D83, thereby modifying the interactions ... like the G51V mutant (Table 2) A correlation could be established between the maximum capacity of Gt activation of these mutants and the stability of their corresponding active states The mutants...

13
428
0

Báo cáo khoa học: Lipid-induced conformational transition of the amyloid core fragment Ab(28–35) and its A30G and A30I mutants docx

Ngày tải lên : 23/03/2014, 07:20

... changes in the WT peptide and its mutants The CD spectra of the WT and A30I peptides showed a b-sheet structure in the presence of PG vesicles For the A30G mutant, a reduction of the coil peak ... shown) These results therefore excluded the possibility that the Trp-modiﬁed peptides used in the subsequent experiments (see below) behaved differently from the WT peptide and its two mutants ... the peak maxima of 14, and 19 nm for the WT ⁄ W27, A30G ⁄ W27 and A30I ⁄ W27 peptides, respectively (Fig 4A–C) On the other hand, the spectra of the C-labeled peptides showed an increase in the...

13
336
0

Báo cáo khoa học: Crystal structures of HIV protease V82A and L90M mutants reveal changes in the indinavir-binding site potx

Ngày tải lên : 23/03/2014, 12:20

... to the values in the two mutants Ile50¢ was ordered in all three structures and the side chain ﬁtted well in the S2 binding pocket created by the t-butyl group of indinavir Ile50, on the other ... while the L90M structure in space group P212121 included a sulfate and an acetate ion All the ions were observed on the surface of the protein Among the three complexes, the quality of the electron ... the conformations of the side chain of Lys45 in PR forms hydrogen bonds with the Od2 of Asp30, which is expected to stabilize the ﬂap The other conformation of Lys45 forms hydrogen bonds to the...

9
355
0

Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong inﬂuence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt

Ngày tải lên : 23/03/2014, 21:20

... in the absence or the presence of acetate stress The trp5D mutant is clearly much more sensitive than the wild-type to the inhibitory effects of acetate under these conditions (Fig 4A,B) The ... obtain evidence of whether this is the case, we studied the effects of overexpressing the high afﬁnity tryptophan permease, Tat2p [16] The TAT2 gene was placed under the control of the strong, constitutive ... also compromised under these conditions (not shown), their growth being essentially similar to that of the trp5D mutant cells shown in Fig All of these mutants, unlike the BY4741 parent, must...

7
391
0

Báo cáo hóa học: " Herpes simplex virus type-1(HSV-1) oncolytic and highly fusogenic mutants carrying the NV1020 genomic deletion effectively inhibit primary and metastatic tumors in mice" pptx

Ngày tải lên : 20/06/2014, 01:20

... sequencing to ensure the stability of the viral genomes, the presence of the parental Onc deletions and the presence of the gKsyn1 mutation within the gK gene, as described previously for the OncSyn virus ... [38] Therefore, to further increase the ability of the OncSyn virus to fuse all types of cells, we generated the OncdSyn virus carrying both the gBsyn3 and gKsyn1 mutations As expected, the OncdSyn ... prior to (negative values on the x axis) and after the injections "0" on X axis represents the day of the first injection The tumor volumes were determined from the formula: volume = (length...

10
340
0

Báo cáo khoa học: "Localization of antigenic sites at the amino-terminus of rinderpest virus N protein using deleted N mutants and monoclonal antibody" doc

Ngày tải lên : 07/08/2014, 17:22

7
179
0

Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt

Ngày tải lên : 08/08/2014, 18:21

... containing the unique C-terminus of the NPM-mA protein It indicated that the specific polypeptide generated by the C-terminus of the NPM1 (type A) mutation may be an optimal immunogen Over the past ... shown B, Negative control; the bone marrow from the same case as in (A) was stained with PBS substituting for the 2G3 mAb Discussion Mutations involving the NPM1 gene are the most frequent genetic ... existing in the cytoplasm and cause false positives In this study, we analyzed the antigen epitope of NPM-mA protein and confirmed it may exist in the C-terminal domain of the NPM-mA by using the Protean...

6
431
0

Báo cáo khoa hoc:"Mapping the Naked Neck (NA) and Polydactyly (PO) mutants of the chicken with microsatellite molecular markers" docx

Ngày tải lên : 09/08/2014, 18:21

... between the NA locus and ADL0237 in the distal region of chromosome 3q These results contribute to connecting the former classical map to the molecular genetic map of the chicken, and open the way ... assigned to the linkage group IV of the “classical” map [20] The naked neck mutation is characterised by a reduction of feathered areas, mainly of the neck, but also in other regions such as the ventral ... sequencer The results from the pooled samples and the sire were analysed with Genotyper software (ABI) Markers that were homozygous in the sire or which showed the same alleles in the sire and the...

14
235
0

báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

Ngày tải lên : 11/08/2014, 11:21

... oxygenated carotenoids The mutant also exhibited reduced synthesis of ABA However, the specific alteration of the carotenoid biosynthesis pathway in Pinalate is currently unknown [17] The nan spontaneous ... of the 90 cDNAs that were found to be simultaneously down-regulated in both mutants were coincident with the known deleted genes of 39B3 and 39E7 Therefore, they are not expected to reduce their ... 39E7 mutants highlighted major biochemical features underlying peel colour progression (Table and 3) Thus, “photosynthesis” was one of the pivotal enriched categories in the mutants due to the...

14
400
0

Báo cáo y học: "Broader HIV-1 neutralizing antibody responses induced by envelope glycoprotein mutants based on the EIAV attenuated vaccin" ppt

Ngày tải lên : 13/08/2014, 01:20

... not match the mutation sites (Figure 5) We hypothesized that there were conformational changes induced by the modification because the locations of the epitopes were interspersed in the whole ... gp145 c) Schematic figure of the EIAV D510 V3, V4 regions and the HIV-1 CN54 V1, V2 regions The left figure shows the EIAV V3, V4 regions; the right figure shows the HIV-1 V1, V2 regions N-Glycosylation ... by the IFN-g-based ELISPOT assay after stimulation of splenocytes with SHIVchn19 peptides from the ENV1 and ENV2 pools The ENV1 pool is made up of the first 43 peptides (4830-4871), and the others...

13
307
0

Báo cáo y học: "HTLV-1 Tax mutants that do not induce G1 arrest are disabled in activating the anaphase promoting complex" pdf

Ngày tải lên : 13/08/2014, 05:22

... responsible for the design of the study and the draft of the manuscript RM performed most of the experiments CC isolated the tax mutants and assisted in the reporter assays SH assisted in the analyses ... p21CIP1/WAF1and p27KIP 1in the HeLa cells expressing the various tax alleles suggest that the S cerevisiae-viable tax mutants are impaired in APC/C activation To determine the effect of the tax mutants on APC/C ... assays and the extent of I-κB degradation and p100 processing These mutants are nevertheless impaired in elevating p21CIP1/WAF1and p27KIP 1levels These results support the notion that the NF-κB...

12
302
0

Báo cáo y học: "Application of the comprehensive set of heterozygous yeast deletion mutants to elucidate the molecular basis of cellular chromium toxicity" potx

Ngày tải lên : 14/08/2014, 08:20

... Analysis the global effects of Cr treatment on the heterozygous mutants Analysis of the global effects of Cr treatment on the heterozygous mutants The plot shows the distribution of the sizes of the ... from the Cr-treated cells Therefore, aggregated protein formed in the presence of Cr can exert a toxic effect (In the latter case, there was a decrease in the proportion of labeled protein in the ... decrease in protein synthesis that is at least as marked as that provoked by H2O2 Therefore, the ability to respond by decreasing the rate of protein synthesis is not the only factor determining...

10
371
0