the cluster forming activity assay a short term in vitro method to analyze the activity of mouse spermatogonial stem cells
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc
... intensities with minimum (< 1% spots) intensity saturation Microarray data analysis The resulting gene expression data files were uploaded to the mAdb database and further analyzed using BRBArrayTools developed ... Baccini A: CCA: An R Package to Extend CanonicalCorrelation Analysis Journal of Statistical Software 2008, 23(12):1-14 Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa ... T, Kimata M, Tachikawa K, Koshimizu T, Okada T, IharaWatanabe M, Sakai N, Kogo M, Ozono K, Michigami T: Involvement of nuclear factor I transcription/replication factor in the early stage of chondrocytic...
- 17
- 593
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al ... 3’) SEA SED M18970 M28521 cttgtacatatgagcgagaaaagcgaagaa cgttctcgagaatgaaaacattgattc gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata ... gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat...
- 9
- 568
- 0
Báo cáo y học: "Hedgehog overexpression leads to the formation of prostate cancer stem cells with metastatic property irrespective of androgen receptor expression in the mouse model" pps
... neuroendocrine cells and might bypass AR signalling for survival and proliferation PCSCs progeny differentiated into basal-intermediate and intermediate-luminal cells Since our data had indicated that ... Figure 2F to 2J), in contrast to the normal slim and flat basal cells (indicated by arrows in the magnified areas of Figure 2A to 2E) These data strongly suggest that the prostate cancer cells are ... (d) of panel C CaP: prostate cancer; HE: hematoxylin-eosin stain; PIN: prostatic intraepithelial neoplasia; HGPIN: high grade prostatic intraepithelial neoplasia basement membrane of the vehicle...
- 11
- 446
- 0
Effects of combined mechanical and pulsed electromagnetic field stimulations on the osteogenesis of bone marrow stem cells
... bones and interstitial spaces of cancellous bones The metabolic functions of bone are storage of minerals, growth factor and fat, acid-base balance, detoxification and as an endocrine organ Minerals, ... vascular endothelial damage leads to the initiation of the complement cascade, platelet aggregation and release of its α-granule contents Hematoma accumulates within the medullary canal between the ... Secondary fracture healing can be divided into three main phases: the inflammatory, reparative and remodeling phase These phases overlap one another, effectively forming a continuous healing process...
- 209
- 1,817
- 0
Báo cáo y học: "Effect of a short-term HAART on SIV load in macaque tissues is dependent on time of initiation and antiviral diffusion" pot
... Statistical analysis Statistical analyses were carried out using Stat View software (SAS institute Inc, Cary, North Carolina, USA) Plasma and cell-associated viral load as well as SIV-RNA, total ... killed at the end of treatment In the blood, the treatment induced a decrease of the plasma viral load (a) , but a weak impact on the cell associated viral load (b) In tissue, total SIV DNA and 2LTR ... Figure Viral dynamics in SIV-infected macaques receiving a short- term HAART just after the viremia peak Among animals infected since 14 days, animals received the AZT/3TC/IDV combination (HAART d14-d28:...
- 11
- 336
- 0
Báo cáo sinh học: " A short-term divergent selection for resistance to Teladorsagia circumcincta in Romanov sheep using natural or artificial challenge" pptx
... grazing animals, the pasture in each paddock was sampled on the first and last day of the grazing period and the larvae were extracted and counted [16] At the same time, grass availability was ... with an average annual rainfall of 740 mm), pasture, left ungrazed for a year, was sown with fescue and rye grass in the preceding autumn to remove any remaining population of gastrointestinal infective ... cages This estimate gave acceptable data in 1990, but not in 1992, when the estimated feed availability was too high The dead material in the pasture in 1992 was not taken into account, leading...
- 26
- 231
- 0
báo cáo hóa học:" Anti-tumor activity of patient-derived NK cells after cell-based immunotherapy – a case report" doc
... another 12 months after the therapy had been terminated A scheme of the therapeutic approach and the course of the disease are summarized in Figure Identical to the protocol of the clinical phase ... perforin and granzyme B provided insight into the lytic activity of infiltrating T and NK cells In the primary tumor and in the anastomotic relapse there was a strong infiltration of CD3+/CD4+ T cells, ... carcinoma A B Anastomotic relapse C Figure A- Photomicrograph view of the patient-derived cell line of the anastomotic relapse A- Photomicrograph view of the patient-derived cell line of the anastomotic...
- 18
- 541
- 0
báo cáo hóa học:" Serous papillary adenocarcinoma possibly related to the presence of primitive oocyte-like cells in the adult ovarian surface epithelium: a case report" docx
... prepared the ovarian tissue sections to be analyzed, performed a classical histological analysis, and diagnosed the ovarian cancer All authors read and approved the final manuscript Competing interests ... epithelium of fetal ovaries, and might have been involved in the manifestation of serous papillary adenocarcinoma in this patient They expressed the analyzed markers of pluripotency SSEA-4 and ... common among ovarian cancers Ovarian cancers account for percent of all cancers among women according to the American Cancer Society The five-year survival rate in women with advanced ovarian cancer...
- 5
- 406
- 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M: Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor-chains (CD25) Breakdown of a single mechanism of self-tolerance ... the predominant TGF-β effect on T cells in this fraction is the generation of ‘professional’ regulatory T cells remains to be determined Our finding that both IL-2 and TGF-β are critical in the ... http://arthritis-research.com/content/4/4/241 pathway that a naive T cell will take following activation These include the antigen concentration and route of administration, the cytokine milieu, and the pattern of...
- 6
- 408
- 0
Báo cáo y học: "Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study" pptx
... was obtained from an indwelling arterial or venous catheter Plasma was separated from the blood samples at the time of blood draw and frozen at 70°C until assayed Measurement was done in a blinded ... modification to the initial description increased the precision and dynamic (i.e signal to noise ratio) of the assay, and allowed measurement of pro-ANP in serum and plasma (with EDTA, heparin, ... manner as a batch analysis Mid-regional pro-ANP (epitopes covering amino acids 53–90) was detected in EDTA plasma from all patients with a new sandwich immunoassay (BRAHMS Seristra® LIA; BRAHMS...
- 9
- 254
- 0
Báo cáo khoa học: " A long-term follow-up study investigating health-related quality of life and resource use in survivors of severe sepsis: comparison of recombinant human activated protein C with standard care" pot
... assumption that the missing data are similar to the nonmissing data, but rather the less strict assumption that the missing values are similar to nonmissing values for patients of the same age, treatment ... participated in patient enrolment, and participated in writing and revising of the manuscript AGD provided statistical analysis of results and interpretation, and participated in the writing and ... decision maker Contact information for both the patient and next of kin was obtained To avoid an imbalance between APC and standard care patients from each site, each participating site enrolled in...
- 11
- 376
- 0
A short course in digital photography
... just a few such uses Peggy Curtin took this photo of a miniature St Paul's Cathedral while leading a tour of Prince Edward Island in Canada There is a grand tradition of photographing on the street, ... with these kinds of cameras rather than traditional film-based cameras Photographers who don't accept digital cameras generally base their arguments on the fact that the images are not as good as ... linear sensors Area-array Sensors Most cameras use area-array sensors with photosites arranged in a grid because they can cover the entire image area and capture an entire image all at once Area...
- 153
- 432
- 0
A short course in canon EOS 450d photography
... the Playback button to return to the camera settings screen JuMPinG in PLaYBaCk In single image playback mode, it takes time to navigate through images when there are many of them on a card To ... pixels Each photosite captures a single pixel in the photograph to be An image sensor against a background enlargement of its square pixels, each capable of capturing one pixel in the inal image the ... press the shutter button halfway down and then release it to activate metering Pointer icons on the monitor indicate you can turn the Main Dial to adjust settings Turn the Main Dial to select an aperture...
- 156
- 178
- 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx
... GACTTACATA-3¢ and DS: 5¢CACCTAAGACACTGTG GAAGAGCAG-3¢; mouseHS2 US: 5¢GGGTCTCTCTA GGAGGAAGTCCACAGG-3¢ and DS: 5¢CAGATCTAAT GACCCTAACTCTAAC-3¢; mouse bmajor US: 5¢GGT GCACCTGACTGATGCTGAGAAG-3¢and ... ACACATGGTCATCTATCTGAGC-3¢; mouse HS2 core: US 5¢-TTCCTACACATTAACGAGCCTCTGC-3¢ and DS 5¢AACATCTGGCCACACACCCTAAGC-3¢; ⁄ 2flank, US 5¢-CTATTTGCTAACAGTCTGACAATAGAGTAG-3¢ and DS 5¢-GTTACATATGCAGCTAAAGCCACAAATC-3¢; ... 5¢-CCCACAGGCAAGAGACA GCAGC-3¢; mouse ec-globin: US 5¢-CAAAGAGAGTTT TTGTTGAAGGAGGAG-3¢ and DS 5¢-AAAGTTCACCA TGATGGCAAGTCTGG-3¢; mouse HS3 core: US 5¢-TG TTTCCCTGATGAGGATTCAATGG-3¢ and DS 5¢-CCC ACACATGGTCATCTATCTGAGC-3¢;...
- 10
- 422
- 0
Báo cáo khoa học: The mitochondrial permeability transition from in vitro artifact to disease target ppt
... set of proteins involved in the effector phase of apoptosis [74–77] A rigorous test of whether a PT takes place in intact cells, organs and living organisms remains a major challenge This is caused ... variability of dose and timing reflects the basic uncertainty of whether the PTP is actually inhibited after the administration of CsA in vivo, and of whether more than a single dose is necessary ... as a survival-signaling molecule acting on target(s) other than the PTP [185] This dual function could lead to a balance of the pro-apoptotic and anti-apoptic effects of the protein in animals...
- 23
- 345
- 0
Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx
... Mediator and GTFs Purification of the Gal4 DNA binding domain, Gal4-AP2, Gal4-VP16 and GAL4-CTF The gene that encodes the Gal4-AP2 transcriptional activator, which contains the Gal4 DNA binding ... (lane 11), indicating that the Mediator is involved in activated transcription Neither the inclusion of human recombinant TFIIA nor the Gal4 DNA binding domain had an effect on activated transcription ... described in Materials and methods with 50 ng of the Ad-MLP promoter and the amounts of RNAPII holoenzyme, RNAPII, activators, and GTFs indicated at the bottom of each panel (A) Analysis of the amount...
- 12
- 412
- 0
báo cáo hóa học:" yuDetecting the percent of peripheral blood mononuclear cells displaying p-STAT-3 in malignant glioma patients" pot
... various stages of preclinical and clinical trial testing A limitation of this assay is that an increase in the mean percentage of PBMCs displaying p-STAT-3 was not detected in all cases of malignant ... growth and increased malignancy In many malignancies, the signal transducer and activator of transcription (STAT-3) plays an integral role in modulating oncogenesis, inhibiting apoptosis, and suppressing ... GNF, and ABH participated in data collection, and WH, YW, WQ, CR-O, JW, GFN and ABH participated in the data analysis and the interpretation of results WH, YW and ABH contributed to the writing of...
- 9
- 462
- 0
báo cáo hóa học: " Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pptx
... to the manuscript MdeW contributed to the quality of data management and the manuscript NZ coordinated the assessments in the diabetes outpatient clinic and data management FJS conceived of the ... study was to evaluate the validity of the PRIMS-RII as a measure of suffering in people with diabetes Although the concept of suffering is abstract, the vast majority of patients was able to complete ... of the illness itself, but rather by the perceived threat it poses to the intactness of the self, i.e the impact and meaning a disease has for a patient In addition, personality factors are assumed...
- 7
- 410
- 0
báo cáo hóa học: " A refined in vitro model to study inflammatory responses in organotypic membrane culture of postnatal rat hippocampal slices" potx
... pro and anti-inflammatory stimuli during the culture Next, we wanted to see if either proinflammatory histone deacetylase inhibitor TSA or anti-inflammatory NF-κB inhibitor helenalin could influence ... understanding of innate and adaptive immune interactions and responses Downstream, a well known family of transcription factors, the nuclear factor kappa B (NF-κB), is one of the key players in the ... proinflammatory stimuli in a similar manner as they later on Also, based on the data from the temporal profile of LPS response, we conclude that NF-κBmediated inflammatory markers can be measured...
- 15
- 345
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25