0

the bedrock of a culture

The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

Tài chính doanh nghiệp

... Sustainability‖ is an indicator variable that takes the value of one if a firm is included in the High Sustainability group. ―Size‖ is the natural logarithm of market capitalization at fiscal year-end. ... sample, we again use proprietary data obtained through SAM. Panel A of Table 3 presents a comparison between the High and Low Sustainability firms across several data items that relate to actions ... Sustainability‖ is an indicator variable that takes the value of one if a firm is included in the High Sustainability group. ―Size‖ is the natural logarithm of market capitalization at the end of 2009....
  • 57
  • 447
  • 0
the influence of corporate culture of vietnamese companies a study of corporation fpt

the influence of corporate culture of vietnamese companies a study of corporation fpt

Sư phạm

... beliefs and rules that control the management of the company. They also represent the institutional philosophy and the support to the culture of an organization. The main objective of core values ... cultural evaluation of quantitative and qualitative research study of theory, measurement of the CC need to be quantitative research and qualitative research should be a combined point of view. ... view. Although cultural evaluation of the quantitative research has been in a CC dominated the direction of evaluation researchers, but some scholars, the scope of its measurement has always...
  • 77
  • 1,357
  • 14
the emergence of a scientific culture science and the shaping of modernity 1210-1685 feb 2007

the emergence of a scientific culture science and the shaping of modernity 1210-1685 feb 2007

Vật lý

... Library Cataloguing in Publication DataData availableLibrary of Congress Cataloging in Publication DataData availableTypeset by Laserwords Private Limited, Chennai, IndiaPrinted in Great ... behaviour was tantamount to challenging the word of a public authority andwas an unforgivable sign of disrespect and dissension, the ultimate betrayal of filial piety, of familyand clan, and, ... naturalism sought to beat the Church of England at its own cultural game. Like the evangelicals of an earlier day, the honestdoubters and advocates of scientific naturalism demanded a truer and...
  • 574
  • 285
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Điện - Điện tử

... S RNA of TULV.GGAAAUG GCCAAGUG-C A- UG-C A- UU -A G GU -A G:UC A- UU -A 337 381(+) senseU:GU -A C UC-GU -A C-GU -A C-GU -A A-UC C A- UC A GU -A A-U(-) sense A C A- UG A G-C A- UCCUUUAC ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt831–855). To monitor the presence of recTULV S RNA,RT-PCR was performed with primers RECF738(5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) andHairpin-like ... no real match to the original cell adapted variantand that the lower fitness of the recombinant virus can notbe increased by pre-passaging in cell culture. The observedsurvival time of the...
  • 5
  • 483
  • 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

Hệ điều hành

... prevent.• Data manager changes data. A malicious data manager may change the value of its data on each cacherefresh. While this is an advantage for shared memory applications, it is a serious ... temporarily allow read-only access to cached data. The locking on a page may later be changed as deemednecessary by the data manager. [To avoid race conditions, the pager_data_provided call also ... to the default pager is identical to other external data managers, there are no fundamentalassumptions made about the nature of secondary storage. For example, the default pager may use local...
  • 23
  • 1,290
  • 1
List the components of a radio system

List the components of a radio system

Kĩ thuật Viễn thông

... sent–Imprints a unique address on the data– The longer the code is, the more users will be able to share the same channel–Number of chips in the code•Determines the amount of spreading or bandwidthWireless ... (TDMA)–Divides the transmission time into several slots–Each user is assigned the entire frequency for the transmission•For a fraction of time on a fixed, rotating basis–Advantages•Uses the bandwidth ... strength falls near the level of noise–Interference can take place•To reduce the interference of noise–Boost the strength of the signal–Use of filters when receiving the signal•Attenuation–A...
  • 30
  • 920
  • 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

TOEFL - IELTS - TOEIC

... lineages of mitochondrial DNA exist among the San (‘Bushmen’) of southern Africa and the Biaka Pygmies of the modern Central African Republic. About 100,000 yearsago, some of these anatomically ... that it awaits further confirmation.8 The forest margin of Cameroun and Nigeria was the region from whichBantu speakers gradually expanded throughout the southern half of Africa. AllBantu languages ... at about 1000bc, they reached the eastern edge of the equatorial forest in the broad area of the great East African lakes. There they settled in well-watered valleys permittingcultivation of...
  • 386
  • 1,222
  • 4
Guest the meaning of a word

Guest the meaning of a word

Kỹ năng viết tiếng Anh

... guest the meaning of a word Could you guest the sign of a new word? Yes, Of couse. This is 20 prefix and 14 root-word helping you improve your vocabulary.You can guest the meaning of 14.000 ... hurl, cast)].offer: ob-và ferre [Gồm các biến dạng fer và lat (Latin: line, bring, carry)].insist: in-và stare [Các biến dạng c a stare là sta, stat, sti, và sist (Greek: standing, stay,make ... talk,speech, speak; word)].aspect: ad-và specere [Gồm có 2 dạng spec và spic (Latin: see, sight, look, appear, behold,and examine)].uncomplicated: un-, com-,và plicare [Có 11 biến dạng sau:...
  • 2
  • 871
  • 1
Báo cáo y học:

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Y học thưởng thức

... and Methods: The data obtained from all of the four university hospitals, and one referral tertiary-care educational state hospital in Ankara. Antimicrobial resistance profiles of 14,233 selected ... Hospital setting and antibiotic policy: NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the ... we have esca-lated all antibiotic prices. The cost of antibiotics was calculated as US dollars (USD). Statistical Analysis: Rates in every 6 months periods of the study period were analyzed...
  • 6
  • 692
  • 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

Kinh tế - Thương mại

... wise to adopt the internal law as governing law to the contract. On the other hand, the parties can agree toadopt a certain world law regarding international trade that can listed here as CISG(Convention ... aninternational transaction. Unless parties are assured that the coverage is available in the amount designated, the failure of a party to obtain insurance coverage shouldnot be grounds for termination of ... in anamicable way. If the parties fail to read an agreement in such way, the dispute shall be brought to the Central of the International Arbitration under Chamber of Commerce and industry of...
  • 41
  • 614
  • 0
Tài liệu The message of a master - By John McDonald pdf

Tài liệu The message of a master - By John McDonald pdf

Tâm lý - Nghệ thuật sống

... said: the great masses of humanity are using the Law destructively, or partially so, and the scales are balanced against them. Here and there, among the masses, we find an occasional outstanding ... as the beasts of the field, the birds of the air and the fish of the sea are bountifully supplied. For any man, no matter what his station in life, to take the stand that it is the destiny of ... that I had met my deliverer, and at the close of the performance was overjoyed at his invitation to accompany him to a nearby café. I noticed that the attention of those in the café was drawn...
  • 50
  • 861
  • 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Kỹ năng bán hàng

... sophisticated information systems and data warehouses been able to manage a great deal of data. The challenge is to capture and measure soft and qualitative information. For example, in the book The Experience ... can wonder if the popularity of non-financial measures from an academic point of view is accompanied by the same success from a managerial perspective. There are a few researchers who have analysed ... conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that they focus on the estimation of cash flows and accounting criteria (Kim,...
  • 15
  • 796
  • 0
Tài liệu Exporting the Results of a Query as a String docx

Tài liệu Exporting the Results of a Query as a String docx

Kỹ thuật lập trình

... that separate columns. The default value is the TAB character. rowDelimiter The character or characters that separate rows. The default value is the CARRIAGE RETURN character. nullExpr A string ... table. SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dt = new DataTable(ORDERS_TABLE); ... creating a DataTable containing the Orders table from Northwind. The GetString( ) method in this solution is called to convert the DataTable into a string similar to one that is generated by the...
  • 4
  • 388
  • 0
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Kỹ năng bán hàng

... expectations and the performance of the organization’s offerings (see e.g. Parasuraman et al., 1985 & 1988 & 1991). Another stream of research is the performance-based approach (or linear ... & Kawani, 1982). Therefore, it can be argued that the aggregate satisfaction of the buying organization is a rather complex function of satisfactions of individual, from an importance viewpoint, ... on the satisfaction of the customer organization as a whole or the satisfaction of certain individuals within that organization. These are clearly two different issues, since in the context of...
  • 37
  • 1,063
  • 0

Xem thêm