the aims and objective by the end of the lesson students will be able to knew how to save energy get used to phrasal verbs and a new way of suggestion
Giáo án Anh văn lớp 7 : Tên bài dạy : People and places. Lesson 3: B1 - 2. I.Ojectives : -After the lesson Ss will be able to know more docx
Ngày tải lên :
06/08/2014, 15:22
... -Ask Ss retell the name of some countries in the south-east Asia -Work in pairs to discuss and write the answers on the BB Thai land - Laos - Cambodia - Singapore - Indonesia Malaysia ... *Practice - Play the tape again and then read the text to the exercise True- False - Give the correct answers a) False ( Liz knows nothing about General Giap.) b) False ( The People Army of Vietnam ... pairs) *Production -Ask Ss to retell some things about the General Nguyen Van Giap -Work in pairs to discuss -Speak aloud before the class Consolidation: -Ask Ss to retell the main content of...
- 4
- 654
- 1
Unit 3: At home.Period 17: Lesson 4: ReadI. Objectives: - After the lesson, Ss will be able to pptx
Ngày tải lên :
08/08/2014, 02:20
... questions - Ask Ss to give their answers by both only and in writing - Give answers: a Because children often try to eat and drink them b Because the kitchen is a dangerous place c Because playing ... Reading the text - Ss read the text and check their prediction - Ask Ss to correct if the statements are false b, Comprehension questions: - Ask Ss to work in pairs to find out the answers of the ... Slap the board - Ask Ss to read the statements and guess which is true, which is false - Give T/F statements prediction basing on the part in textbook - Give feedback * While- reading: a Reading...
- 4
- 345
- 0
Lecture Autodesk inventor Multiview projections 1 Glass box theory. After completing this chapter, you will be able to Explain orthographic and multiview projection; identify frontal, horizontal, and profile planes; identify the six principal views and t
Ngày tải lên :
15/05/2017, 13:25
... Placement Arrangement of Views Top and Front are vertically aligned, share width dimension Front and Right are horizontally in line, share height dimension Top and right are not aligned, share ... visible edges on an part Center Lines – used to identify centers of circles and axes of cylinders (holes) Also used to identify symmetry and to show path of motion Multiview Drawing of a Cylinder Centerlines ... dimension Transfer of Depth Every point or feature in one view must be aligned on a parallel projector in an adjacent / related view Line Conventions Alphabet of lines Visible lines – used to represent...
- 14
- 337
- 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene
Ngày tải lên :
26/01/2016, 09:27
... protection of the oxo group at C14, to install the oxo group at C-3 and the allyl group at C-8 The intermediate would then be dehydrogenated and the product subjected to methylation to afford Danishefsky4b,d ... Danishefsky4b,d and Mehta14 have shown that methylation of similar a, b-unsaturated ketones introduces the methyl group in a trans-orientation with respect to the angular methyl group The allyl and oxo ... conformational flexibility of this compound. 2a, 3a No spectrum of the natural compound was available for a direct comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved...
- 3
- 547
- 0
Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx
Ngày tải lên :
20/06/2014, 21:20
... An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur–Ulam problem Choonkil Park1 and Cihangir Alaca∗2 Department of Mathematics, Research Institute for Natural ... dimensional vector space into itself and V¨is¨l¨ a aa [15] gave a short and simple proof of the Mazur–Ulam theorem Chu [16] proved that the Mazur–Ulam theorem holds when X is a linear 2-normed space ... isometry of a real normed linear space onto a real normed linear space is a linear mapping up to translation Baker [12] showed an isometry from a real normed linear space into a strictly convex real...
- 39
- 371
- 0
A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM
Ngày tải lên :
10/07/2015, 14:50
... and pleasurably” Extensive reading is an approach to teaching and learning reading that uses reading materials that are understandable and meaningful to the learner in order for learners to be ... 1998 and 2003 Additionally, reading habit of students in Social Sciences and Arts at Rajshahi university have been declined (Eamin Ali Akanda, Hoq & Hasan, 2013).These researchers state that this ... findings of Camiciottoli (2001) and Ro and Chen (2014) Ro and Chen explain that most of their participants are housewives, so they have to spend much time on personal lives and are unable to spare any...
- 63
- 587
- 1
Vietnamese chitin raw material, the chitin de n acetylation reaction, and a new chitosan alginate gelling concept
Ngày tải lên :
18/07/2016, 20:13
... can be used to determine the DA of chitin The DA is calculated based on the ratio of the absorbance of a probe band and a reference band The probe band provides a measure of the sample’s N-acetyl ... means that all of the energy used to deform the material is lost as heat A real material will have a phase angle between 00 and 900 and will behave either as a solid or a liquid depending on the ... acid and various nitrogen-containing products such as acetonitrile and acetoamide are liberated These compounds can be analyzed by gas chromatography (GC) and the results used to calculate the DA...
- 119
- 370
- 0
Social Accounting Research As if the World Matters: Postalgia and a new Absurdism ,
Ngày tải lên :
11/12/2016, 11:13
... sense of privilege We seek to abandon hubris and the self-indulgence of the precious and embrace what a ‘good’ academic and a ‘good’ social accountant might be Social Accounting and Postalgia The ... and outside an organisation In putting these internal and external systems together, the accountant can generate data, evaluate its probable reliability and determine its appropriateness to the ... articulated by Richard Baker (Baker 2006) may offer a way of articulating the social accounting project and is being developed in a way that offers a richer way in which to conceptualise engaged work of...
- 30
- 342
- 0
5 8 the search for land, gold, and a new life
Ngày tải lên :
11/02/2017, 14:59
... February 1836 Santa Anna’s army was then defeated by Sam Houston’s troops in April 1836, and Santa Anna was captured In exchange for his freedom, Santa Anna promised not to try to recapture Texas ... he was arrested and shot Santa Anna surrenders to Sam Houston, who was wounded in the Battle of San Jacinto 10 Santa Anna declared that Mexico was now a republic Men were given the right to vote, ... enslaved African American woman He headed west when he was given his freedom A pass he found through the Sierra Nevada later became part of the overland trail to California Kit Carson was a mountain...
- 10
- 343
- 0
5 8 the search for land, gold, and a new life
Ngày tải lên :
18/04/2017, 15:54
... February 1836 Santa Anna’s army was then defeated by Sam Houston’s troops in April 1836, and Santa Anna was captured In exchange for his freedom, Santa Anna promised not to try to recapture Texas ... he was arrested and shot Santa Anna surrenders to Sam Houston, who was wounded in the Battle of San Jacinto 10 Santa Anna declared that Mexico was now a republic Men were given the right to vote, ... enslaved African American woman He headed west when he was given his freedom A pass he found through the Sierra Nevada later became part of the overland trail to California Kit Carson was a mountain...
- 10
- 222
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... nước trong”, “Gạo Cần Đước, nước Đồng Nai”, “Cơm Nai, R a; cá Rí, Rang” hay: “Ai miệt Tháp Mười, Cá tôm sẵn bắt, l a trời sẵn ăn ” (ca dao) v.v Trong Gia Đònh thành thông chí (GĐTTC) có đoạn:...
- 137
- 853
- 0
Đề tài " Analytic representation of functions and a new quasianalyticity threshold " doc
Ngày tải lên :
29/03/2014, 07:20
... are linear, increasing and onto so that they are defined uniquely by their domain and range As will become clear later, the ω(n) factor above is what determines the rate of decrease of the coefficients ... Annals of Mathematics, 164 (2006), 1033–1064 Analytic representation of functions and a new quasi-analyticity threshold By Gady Kozma and Alexander Olevski˘ ı* Abstract We characterize ... and the increase of F near the singular points of the boundary was investigated for F from the Nevanlinna class; see Shapiro [S66], Shamoyan [S95] and Bourhim, El-Fallah and Kellay [BEK04] In particular,...
- 33
- 293
- 0
Báo cáo hóa học: " Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease" pot
Ngày tải lên :
20/06/2014, 01:20
... Cascavel – PR Cascavel – PR Sta Helena de Goiás – GO Piracicaba – SP Piracicaba – SP Piracicaba – SP Piracicaba – SP Piracicaba – SP Piracicaba – SP Brasília – DF Brasília – DF Acreuna – GO Presidente ... design of the study MFSV conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements ... formed by isolates CV2 and PO1 (bootstrap of 96%) and a large cluster containing almost all of the other sampled isolates (bootstrap of 86%) PL3 appeared to be the most divergent isolate, since...
- 13
- 386
- 0
Báo cáo y học: "The journal ‘chiropractic & osteopathy’ changes its title to ‘chiropractic & manual therapies’. a new name, a new era" pdf
Ngày tải lên :
13/08/2014, 15:21
... global acceptance and marks the start of the next phase of growth of the journal including application for an impact factor and MEDLINE listing There have also been key changes to the journal’s ... COCA and EAC to cover the cost of article-processing charges for all manuscripts submitted before April 2011 This will enable Chiropractic & Manual Therapies to remain an international open access ... editorial team with two new Associate Editors from Europe joining the team Professor Charlotte Leboeuf-Yde (Denmark) and Dr Sidney Rubinstein (The Netherlands) add to the depth and breadth of the...
- 2
- 165
- 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
Ngày tải lên :
13/11/2014, 10:46
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...
- 144
- 306
- 0
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model
Ngày tải lên :
26/09/2015, 09:39
... wounding The original wounded area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area for each group of rats The data of 6th ... percent original area; the areas at day 3, and9 are calculated as the percentage of the original area for each group of rats The data of 6th day suggests the largest difference among groups with ... BX51) at 400X magnification - 42 - Chapter Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied...
- 80
- 424
- 0
3244 the messy room there be prepositions to be 4 tasks keys included 3 pages editable
Ngày tải lên :
25/08/2016, 14:15
... or false [T] and explain when it’s false: The desk is between the dresser and the armchair [ F ] THE DESK IS BETWEEN THE DRESSER AND THE BED The third drawer of the dresser is open [ F ] THE ... shelf l) The pillows are under / on the bed k) The purple sweater is on / in the drawer l) The pair of jeans is next to / on the bed m) The bed is under / against the wall n) The poster is against ... some books and magazines on the desk [F ] THERE ARE SOME BOOKS AND MAGAZINES UNDER THE DESK Reorder the sentence adding “there is, there are, there isn’t, there aren’t” according to the picture:...
- 3
- 333
- 1
Bài soạn Can,could and be able to
Ngày tải lên :
24/11/2013, 20:11
... in the end Jack was able to beat him (= he managed to beat him in this particular game) Nhưng có lần có đấu căng thẳng với Alf Alf chơi hay cuối Jack đánh bại (= Anh ta tìm cách đánh bại Alf ... sau: Jack was an excellent tennis player He could (= he had the ability to beat anybody) Jack đấu thủ quần vợt tuyệt vời Anh ta thắng - But once be had a difficult game against Alf Alf played very ... - The fire spread through the building very quickly everyone was able to escape Ngọn l a lan khắp nhà nhanh người tìm cách thoát thân (không nói “could escape”) - They didn’t want to come...
- 2
- 3.3K
- 65
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2