the account shall be credited generally with a debit to accounts in subgroup 57 or to the accounts representing contribution in kind

**Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt**

Ngày tải lên : 23/03/2014, 20:22

... DNA-binding domain in an active conformation RLjunRP is an 40 kDa protein that forms an 80-kDa protein–DNA adduct To assess approximate molecular mass of the factors interacting with the )148 to )124 ... intestine alkaline phosphatase (shown at the top) prior to its addition to EMSA Lane shows the complex formed between RNE-d treated with heat inactivated alkaline phosphatase (10 U) and labelled ... Phosphatase-treated nuclear extracts were assayed for their DNA-binding capacity in standard EMSA UV crosslinking of DNA–protein adduct The EMSA reaction was carried out using ng labelled Jun)25 and...

9
449
0

báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

Ngày tải lên : 18/06/2014, 19:20

... Boas MHA: Northern Uganda IDP Profiling Kampala: UNDP/ GoU/FAFO; 2005 Internally Displaced Camps in Lira and Pader, Northern Uganda A Baseline Health Survey Preliminary Report [http://www.msf .or. jp/news/baseline/Baseline.pdf] ... pre-testing to check for errors or problems The data collectors were all fluent in Luo and English A final forward and back-translation was then produced and a final review conducted by the study team ... Caspiyavin Y, Bollini P, Truong T, Tor S, Lavelle J: The Harvard Trauma Questionnaire – Validating a Cross-Cultural Instrument for Measuring Torture, Trauma, and Posttraumatic-Stress-Disorder in Indo-Chinese...

10
647
0

Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf

Ngày tải lên : 11/08/2014, 17:21

... by the Editor -in- Chief of this journal Author’s contributions TH was involved in drafting the manuscript and in the review of the literature and in performing the clinical follow-up HG was involved ... involved in drafting the manuscript and in the review of the literature SH participated in the surgery and was involved in the clinical follow-up JR participated in the surgery, was involved in the ... been previously described, and various types of autologous materials have been used in order to bridge urethral defects [1] In some cases, the search for new applicable materials became mandatory...

4
292
0

Designing a supplementary reading syllabus with a view to improving reading skills for the first-year English majors at Hai Phong Private University

Ngày tải lên : 19/03/2015, 10:28

... if they are not taken into account in the organization of the material Basing on the theory on syllabus type and the results from the needs analysis, the integrated syllabus which is a combination ... social being and as individual), and the activities which take place in the classroom Other advocators for the broad view on syllabus are Dubin and Olshtain These two scholars (1986: 28) point ... learning, it is advisable for teachers to break it down into manageable units  A syllabus also gives both teachers and learners a moral support in which it makes the language learning become manageable...

83
992
1

Tài liệu Updating a DataSet with a Many-to-Many Relationship ppt

Ngày tải lên : 26/01/2014, 10:20

... insert, and update records in the data source are specified for each The LoadData( ) method is called to retrieve data for each table in the DataSet Finally, the default view for the parent and ... from the DataSet LoadData( ) is then called to load all data from the data source into the parent, child, and junction tables in the DataSet The 11 stored procedures used in this example are shown ... the DataSet back to the data source by calling in the correct order the Update( ) method of the DataAdapter object for subsets of the data in each of the parent, child, and junction tables Create...

19
304
0

Estimating Inﬂation Expectations with a Limited Number of Inﬂation-Indexed Bonds ∗ doc

Ngày tải lên : 15/03/2014, 07:20

... are our three latent factors.3 Since the latent t t t factors are unobserved, we normalize ρ to be a vector of ones, 1, so that the in ation rate is the sum of the latent factors and a constant, ... essentially start with the in ation forward rate, which they decompose into in ation expectations and in ation risk premia Due to a lack of data, we cannot this, and instead we estimate in ation forward ... and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data forecasts...

32
347
0

RESEARCH DISCUSSION PAPER: Estimating Inﬂ ation Expectations with a Limited Number of Inﬂ ation-indexed Bonds doc

Ngày tải lên : 22/03/2014, 20:20

... these in ation forecasts to the latent factors, and use the past forecasting performance of the in ation forecasts relative to realised in ation to calibrate the standard deviation of the measurement ... latent factors.5 Since the latent factors are unobserved, we normalise ρ to be a vector of ones, 1, so that the in ation rate is the sum of the latent factors and a constant, ρ0 We assume that ... high in ation in Australia Interestingly, there appears to have been a sustained general rise in inﬂation expectations between 2004 and 2008 at all horizons Again this was a time of rising domestic...

39
395
0

CANCER PAIN RELIEF - WITH A GUIDE TO OPIOID AVAILABILITY potx

Ngày tải lên : 28/03/2014, 23:20

70
295
0

an oh maser flare with a strong magnetic field in w75n

Ngày tải lên : 28/04/2014, 13:15

... Zeeman pair was probably overlooked by the authors, or dismissed as showing too large a velocity separation d From EVN data are really new as they are related to the ﬂare which took place between ... close to VLA2, at a distance of 55 mas (±40 mas), or at the projected distance of 110 AU (±80 AU) Therefore, the OH masers may well be located in the same shell as the water masers The magnetic ... maser features and the simultaneous dimming of nearby features can be interpreted as originating from the passage of a magnetohydrodynamic (MHD) shock (Alakoz et al 2005) The shock was probably...

2
250
0

Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx

Ngày tải lên : 09/08/2014, 04:21

... Amsterdam Criteria Limitations to obtaining an accurate family history include unavailability of original patient records, unrecognized infidelity within the family, and inaccurate patient recall Indeed, ... negative for cytokeratin and positive for cytokeratin 20, whereas the ureteral tumor stained positive for both cytokeratins, demonstrating a distinct organ of origin for each tumor type and thus ... genotype-phenotype correlations and add to the mutation databases that serve as a reference for genetic diagnosis The history of CRC in the patient's father suggests paternal origin of the MLH1 mutation However,...

6
480
0

Báo cáo y học: "Redo-redo aortic root replacement with a mechanical valved conduit in a patient with von Willebrand’s disease: Case repor" pps

Ngày tải lên : 10/08/2014, 09:22

... into the coronary sinus to stun the heart An aortotomy was performed and 1000 ml cardioplegia was delivered into the left and right coronary ostia Most of the ascending aorta was dissected and removed ... the treatment of choice to prevent peri- and post-operative bleeding The replacement therapy can be monitored by factor assays performed in a specialist haemostasis laboratory [5] Such assays require ... out the study, and wrote the initial manuscript, UB was involved in anaesthetising the patient and collected the relevant literatures, SM anaesthetised the patient and reviewed the manuscript before...

3
270
0

Báo cáo y học: "Clinical factors associated with a conservative gait pattern in older male veterans with diabetes" potx

Ngày tải lên : 10/08/2014, 21:23

... ankle was dorsiflexed maximally with the subtalar joint in a neutral position by palpation The goniometer was aligned with the lateral column of the foot and lateral lower fibula Available dorsiflexion ... univariate analysis used a chi squared test with Fisher's Exact test for dichotomous data and one-way analysis of variance for continuous data The multivariate model was built using a forward ... readily palpable on the plantar surface of the foot An apropulsive gait was defined by visual gait analysis where a patient failed to demonstrate a heel -to- toe gait during the propulsive phase...

5
342
0

Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt

Ngày tải lên : 13/08/2014, 14:20

... history and the physical examination The examination was performed by one chiropractor (examiner A) while the other was allowed only to observe (examiner B) Both filled in an examination sheet without ... Prior to data collection, the participating chiropractors had been informed of the purpose of the study and the rationale for the diagnostic classification system by the first author At a one-day ... was not associated to any of the outcome measures Because of the small numbers within each diagnostic class, statistical testing in relation to agreement was unworkable and the agreement was therefore...

8
293
0

LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN

Ngày tải lên : 22/10/2014, 20:00

... HOW TO TELL THE SEX OF A BIRD THIS IS AMAZING !!! Until now I never fully understood how to tell the difference between Male and Female birds I always thought it had to be determined surgically ... Until now Below are two birds Study them closely See if you can spot which of the two is the Female It can be done Even by one with limited bird watching skills…! Send this to all of the men you ... watching skills…! Send this to all of the men you know, who could with a good laugh, and to all women who have a great sense of humor !!! Collection by FGMLGMU 06/03/2011 ...

4
465
0

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21

... allosterically activate the serpin by displacing the acidic amino terminus from an intramolecular interaction with the basic GAG binding site and freeing it for binding to the thrombin anion-binding ... activated protein C, acrosin, kallikrein, urokinase, tissue plasminogen activator and factor XIa [69–71,74,77– 91] The GAG binding site in protein C inhibitor appears to be localized not to the ... Rezaie AR (1998) Calcium enhances heparin catalysis of the antithrombin-Factor Xa reaction by a template mechanism: Evidence that calcium alleviates Gla domain antagonism of heparin binding to...

10
668
0

The World with a Thousand Moons pdf

Ngày tải lên : 06/03/2014, 00:20

... the air, Walls triggered his atom-pistol The crackling blast of force tore into the body of the charging asteroid-cat, and the beast fell heavily a few yards away But as it fell, the small gray ... Jovian plunged forward, seeking to escape northward But they had come up against an impenetrable abatis of brush Before they could find a way around it, they heard men crashing all around them They ... sprawled on the floor Holk Or, with instant understanding, already had the door of the cabin open They plunged out into the corridor together "Our only chance is to make the bridge and grab the controls!"...

52
408
0

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Ngày tải lên : 06/03/2014, 01:20

... using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... analyzed by using a flow cytometer The behavior in the flow cytometer correlates well with the amount of soluble protein (Fig 3) Interestingly, the strain appears to affect the signal achieved because ... sequence in the T7 vector, AAGGAG, is longer than the one used in the lacUV5 and trc vectors, AGGA (Doc S2) A study by Ringquist et al [23] concluded that the SD sequence UAAGGAGG initiates translation...

11
445
0

Đề tài " The distribution of integers with a divisor in a given interval " ppt

Ngày tải lên : 06/03/2014, 08:21

... estimates for uniform order statistics The author also thanks G´rald Tenenbaum for several preprints of his work and for informe ing the author about the theorem of Rogers mentioned above, and thanks ... probability theory is to ask for the likelihood that a random walk on the real numbers, with each step haveing zero expectation, stays completely to the right of the origin (or a point just to the the ... 1, 2, 3, and in Section The ﬁrst step in all estimations is to relate the average behavior of τ (n, y, z), which contains local information about the divisors of n, with average behavior of functions...

68
409
0

Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Ngày tải lên : 07/03/2014, 16:20

... diagonal (helix A interacting with helix B), then parallel to the diagonal (helix A interacting with helix A of the next repeat), and ﬁnally returning to the diagonal (helix B interacting with A ) ... 5¢-aataatccatgg gggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttc cttatccgatttttcgaagtgc-3¢ PCR products were doubly digested with NcoI and BamHI (New England Biolabs, Beverly, MA, USA), ... (Finland) Data for this study were measured at beamline X12C of the National Synchrotron Light Source We are grateful for the assistance of Dr Anand Saxena in the use of this beamline The National...

14
433
0

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20

... 0.4 A Signiﬁcant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced ... changes being minimal the trapping of two main-chain conformations and increased B-factors at 295 K suggests that the presence of the coordinating Lys in some way can in uence the dynamics of the ... involving dissociation of the axial Met ligand This results in deprotonated protein based ligands such as Lys, His and if available the N-terminal a- amino group competing for the vacant coordination...

15
509
0