the a and p sites
The a and b adapters are used as priming sites for both amplification
... ligase • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A and B adapters are used as priming sites for both amplification and ... Step 1: Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A and “B” adapters are ligated to the blunt ends using DNA ... luciferase, and packing beads used only to keep the DNA beads in place • Above the wells is a flow channel, passing nucleotides and apyrase in a timed schedule PYROSEQUENCING The Chemical Chain • The...
- 19
- 390
- 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... Cu(II) and elemental copper Four and three molar equivalents of Zn(ClO4)2 were added to the a- and b-domains, respectively The pH was adjusted to pH 6.5 by adding potassium phosphate to a final concentration ... molmol: a ¨ program for display and analysis of macromolecular structures J Mol Graph 14, 51–32 Supplementary material The following supplementary material is available online: Table S1 Proton ... similarity This could indicate that each domain adapts to host the additional copper(I) ions by opening up and rearranging its N- and C-terminal parts, minimizing the structural perturbation...
- 14
- 485
- 0
Báo cáo khoa học: The enantioselectivities of the active and allosteric sites of mammalian ribonucleotide reductase pptx
... higher than the apparent Km for d-ADP of 91 lm (Fig 6A, B) As above, this probably reflects retention of the base and especially b-phosphate interactions at the active site and loss of the specific ... to the Ludwig procedure [32] l-ADP and l-ATP were purified to homogeneity, as judged by HPLC and HRMS, by DEAE-Sephadex A- 25 and RP18 chromatography, and converted to the respective sodium salts ... 10 mm With CDP as substrate, the dissociation constants of l-ATP for the s- and a- sites, calculated as described [2], are approximately 200 lm and 1000 lm, respectively These values are three-...
- 7
- 379
- 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... tÞ þ ab ÁexpðÀkb Á ½O2 ÁtÞ ð2Þ where DAnorm is a normalized change in optical density of the sample and aa, ab, k a and k¢b are the amplitudes and rate constants of BR The quantity [O2] is the ... between the ligand and the heme-iron These appears to be a direct relationship between the ability of the anions to shift Val(E11)b closer to the iron atom and its ability to lower the ligand affinity ... both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and dissociation rate constants for the b subunits are found to exceed 2.2 ± 0.3- and...
- 11
- 577
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... indicated that the levels of Hsp90 expression in strains PP30[pHSC82b], PP30[pHSP82], PP30[hHsp9 0a] and PP30[hHsp90b] were comparable, although the Hsp90b expression of PP30[hHsp90b] appeared to be ... described previously [35] A plasmid (pH9 0a) for human Hsp9 0a expression in S cerevisiae was constructed by PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG ... forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA GA) The second PCR used a universal pair of primers [34,48] PJ69- 4a [48] was then transformed...
- 11
- 427
- 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
... GenBank/EBI A transferase A transferase A transferase A (cis A/ B) transferase A- likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase IGb3 synthetase ... room temperature Amplification of the cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA Amplification was performed ... express A or B epitopes The presence of a glycosyltransferase mRNA and the corresponding glycan structure may not always correlate as the mRNA may not necessarily be translated or the appropriate...
- 8
- 499
- 0
báo cáo hóa học:" Expression of Bone Morphogenetic Protein-2 in the Chondrogenic and Ossifying Sites of Calcific Tendinopathy and Traumatic Tendon Injury Rat Models" doc
... staining and RT-PCR and analyzed the data KMC designed the study and draft the manuscript All authors read and approved the final manuscript Acknowledgements This work was supported by equipment/resources ... cDNA by the First Strand cDNA kit (Promega, Madison, WI) The primer sequences and annealing temperature for BMP-2 and -actin were shown in Table The real-time PCR machine, the reaction kits, and ... ossification in our animal models This study aimed to report the spatial and temporal expression of BMP-2 protein and mRNA in both animal models Methods This study was approved by the Animal Research Ethics...
- 6
- 291
- 0
báo cáo hóa học: " The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism" pot
... were analyzed by commercially available software package (Statview, Abacus concepts, inc., Berkley, CA, USA) The data were non-parametric, thus they were presented as median and interquartile range ... in accumulation of lipids inside the cell, and downregulation of the total protein synthesis P proteins are post-translationally modified (dephosphorylated) during apoptosis, and a dysregulation ... performed and wrote the research In addition, both authors read and approved the final manuscript Acknowledgements This work was financially supported by the King Abdulaziz City for Science and Technology,...
- 30
- 522
- 0
Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx
... M: The two NF-kappaB activation pathways and their role in innate and adaptive immunity Trends Immunol 2004, 25:280-288 Silverman N, Maniatis T: NF-kappaB signaling pathways in mammalian and ... prepared for use as templates to generate standard curves All samples were normalized to amplified murine GAPDH GAPDH control was analyzed per plate of experimental gene to avoid plate-to-plate ... CCL5 genes Primer combinations are GAPDH [antisense: 5’ ATG TCA GAT CCA CAA CGG ATA GAT 3’; sense: 5’ ACT CCC TCA AGA TTG TCA GCA AT 3’]; TNF -a [antisense: 5’ AGA AGA GGC ACT CCC CCA AAA 3’; sense:...
- 11
- 622
- 0
Báo cáo y học: " A real-time view of the TAR:Tat:P-TEFb complex at HIV-1 transcription sites" ppsx
... immunoprecipitation data have shown that Tat and P- TEFb are present with elongating polymerases all along the gene [10], we suggest that Tat and P- TEFb could undergo constant association and dissociation ... which can transcribe the entire viral genome P- TEFb is not the only partner of Tat In particular, Tat has also been shown to interact and recruit the histone acetyltransferases p3 00 and PCAF, which ... Basyuk elaborated the final Page of (page number not for citation purposes) Retrovirology 2007, 4:36 version This work was conceived by E Basyuk and A Marcello All authors read and approved the...
- 5
- 174
- 0
The Design and Implementation of a Log-Structured File System
... this purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... the areas of cost and capacity rather than performance There are two components of disk performance: transfer bandwidth and access time Although both of these factors are improving, the rate ... as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved...
- 15
- 1,434
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... 'diagnosis' and 'treatment' whether in managing a given patient in actual practice or in attempting to define an appropriate evidence-based professional 'standard of care' This is perhaps particularly ... and helped write the manuscript Dana Lawrence performed thematic analysis and coding of transcripts and prepared components of the manuscript Robert Rowell also performed thematic analysis and coding ... clinical practice As a corollary example of an empirical 'treatment-based' diagnostic strategy, a presumptive diagnosis of gastroesophageal reflux disease (GERD) may be pragmatically validated in practice...
- 10
- 788
- 0
Natural botanical products have a long history in the world and are featured in using a complex
... Statistical analysis Statistical significance between the treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA), followed by Dunnett t-test and post-hoc analysis ... cell proliferation were expressed as the number of PCNA-positive cells per field [10] The same approach was adopted for measuring apoptosis and angiogenesis in the tumors Assessment of angiogenesis ... treatment groups They were fed intragastrically (i.g.) daily for 14 and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor...
- 9
- 712
- 0
The sociology and psychology of terrorism who become a terrorist anh why
... is produced by the parasympathetic nerve endings and acts to dampen the accelerated norepinephrine response; and endorphins, which develop in the brain as a response to stress and “narcotize” the ... crowded places, using home-made improvised weapons such as knives and axes Such attacks were suicidal because escape was not part of the attacker’s plan These attacks were, at least in part, motivated ... the terrorist act as morally acceptable and the group’s goals as of paramount importance As Shaw (1988:366) explains: Apparently membership in a terrorist group often provides a solution to the...
- 186
- 448
- 3
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... disapproval of the authority and, moreover, his disgust upon the authority The anxiety, disapproval and disgust of the man implied the same feelings and attitude of the author The old lady in the ... informality and individualism as the lifestyle and value of the American, respectively, have not been changed, the other aspects such as racial discrimination, American women and generation gap have ... African-American, American Indian or Alaska native, Asian, native Hawaiian, other Pacific Islander and ethnic groups due to immigrations from all around the world However, when all these races live together...
- 49
- 785
- 1
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school
... integrated into language teaching programs and teaching materials in one way or another Many educators have applied these programs into real classroom activities and teaching materials This has ... from other activities In speaking they need imagination and patience Speakers are quickly made aware of how and where the communication is headed and adapt what they are saying directed by their ... speech in English and pay no attention to the meaning beyond the words The dialogue followed can be seen as an example; a Vietnamese would apply this approach to the situation of an employee asking...
- 38
- 1,225
- 0
the meaning and structure of a narrative a systemic functional analysis
... police, and the Japanese embassy Mode: Mood: declarative Modality: ability of the main character on the past - Medium written channel - High lexical density and parataxis and low grammatical intricacy ... which is the doer of the action When they have two participants, the roles are referred to as respectively as Actor and Goal In some Material processes, the third participant appears It is called ... desideration (wanting) In a mental process, there are always two participants: a Sensor and a Phenomenon The Sensor is the participant who senses, and the Phenomenon is the one who is sensed For example:...
- 39
- 826
- 2
A fairy story - The Lizard and the Damsel
... daughter and said PEASANT – DAUGHTER Then the peasant called his second daughter and said PEASANT – DAUGHTER Then the peasant called his youngest daughter and said PEASANT – DAUGHTER – PEASANT ... NARRATOR PEASANT ‘I will never marry a lizard Sorry, father.’ NARRATOR PEASANT – DAUGHTER NARRATOR PEASANT – DAUGHTER – PEASANT NARRATOR PEASANT – LIZARD NARRATOR DAUGHTER – LIZARD NARRATOR DAUGHTER ... illustration © Macmillan Publishers Ltd 1995 CHAPTER A fairy story The Lizard and the Damsel NARRATOR PEASANT – DAUGHTER NARRATOR PEASANT – DAUGHTER – PEASANT NARRATOR PEASANT ‘It’s the lizard I’ve...
- 16
- 819
- 2
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... develop awareness of the problem in APEC Economies Need appropriate information systems and tools Need to develop and adapt current institutional structures in individual Economies AND the APEC...
- 10
- 583
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25