... correlates with reduced COPD hospitalizations and mortality [28-30], and up to 50% slower decline in lung function (FEV1 and FVC) in smokers, former smokers and non-smokers [9,10] In patients receiving ... assisted in performing the experiments EJ, HU, and ML were responsible for tissue collection and handling JC participated in interpretation of results and the preparation of the manuscript AJH supervised ... and the ensuing effects on prenylationdependent intracellular signaling activity [15-18] Given the biological importance of FT and GGT1, a number of selective inhibitors have been developed and...
... in the manuscript and participated in its design BZ conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the ... proteins Accompanying the increased migratory and invasive phenotype, we also observed elevated production and secretion of MMP-9 and MMP-2 MMP-2 and MMP-9 not only promote a motile cell phenotype ... monolayers in 100% humidity and 5% CO2 at 37°C in serum-free defined growth media (BEGM, Lonza) or keratinocyte media (Invitrogen, Carlsbad, CA) NHBEs were used on passage or NHBE and BEAS-2B cells...
... nucleotide sequence analysis revealed that the longest and intermediate bands were full-length CCN4 ⁄ WISP1 and WISP1v, respectively However, the shortest band was a novel variant of WISP1 (WISP1vx) not ... with the insulin-like growth factor binding protein (IGFBP: first), von Willebrand factor type C repeat (VWC: second), thrombospondin type repeat (TSP1: third), and the C-terminal cysteine knot ... (III), as detailed in Fig 2B (B) Genomic, mRNA and the deduced amino acid sequences are displayed at upper, middle and lower, respectively Alternative and authentic splicing sites are indicated with...
... loss of band a, and partially blocked b with the subsequent appearance of a supershifted complex; anti-Sp3 Ig blocks formation of bands b and c This suggests that band a contains Sp1, band b contains ... the ‘wild-type’ and mutant m4 revealed only one complex to be specific The identity of this, presumably Ets family member, remains to be determined The pattern of three bands (a, b and c) bound to ... contains both Sp1 and Sp3, and band c contains Sp3 Discussion HDACs usually act as transcriptional repressors, therefore HDAC inhibitors should induce expression of susceptible genes, and this is the...
... centrifuged at 3000 rpm for 10 at 4°C, and stored at -80°C for later determination of TGF-β1 Experimental animals and design Equal proportions of male and female Wistar rats at weeks of age, ... forward and reverse primers (5 μmol/μl), μl of cDNA product and water The PCR reactions were run on iQ5 (Bio-Rad) using the following program: 95°C for 15 s, and 40 cycles of 95°C for s and 60°C ... and silica+LvshCD36-NC groups, there was a large infiltration of inflammatory cells and alveolar septal thickening in the lung, and occasionally a small amount of cellular nodules (Stage I) and...
... which was used as a linker to connect the N-terminus of gAd and the C-terminus of GLP-1-A Because the protein produced from plasmid vector PET28a was an N-terminal 6×His-tagged protein, we introduced ... glycine-rich short peptide including 15 amino acids to connect the N-terminus of globular adiponectin and the C-terminus of GLP-1-A Compared with native GLP-1, the fusion protein has a modified site and ... N-terminal His-tagged gAd-GLP-1-A fusion protein and gAd-GLP-1-A fusion protein (A) N-terminal His-tagged gAd-GLP-1-A fusion protein; (B) gAd-GLP-1-A fusion protein Figure Expression of N-terminal...
... IL-1b and transcript level for IjBa (A and B, central panel) and TNFa (A and B, right-hand panel) was examined by real-time PCR Overexpression of MCPIP was verified by western blotting (A, left-hand ... mode and stage of MCPIP action still need to be determined Altogether, observations concerning the mutual regulatory effect between MCPIP and NF-jB, its implication in the inflammatory state and ... with 50 nM MCPIP siRNA (lanes 12 and 13) or scrambled siRNA (lanes 10 and 11) and plated on a 12-well plate In addition, untreated cells were analysed (lanes and 9) After 48 h cells were stimulated...
... These images were from hippocampal CA1 and two cortical regions, one at the midline and another at the superior aspects of the temporal cortex and were acquired and analyzed using NIS-Elements BR3 ... (SB203580), ERK (U0126), and JNK (SP600125) pathways were from Calbiochem Medium, serum, and B27 supplement for cell cultures were from Invitrogen/Life Technologies (Grand Island NY) The antibodies ... Apolipoprotein E and beta-amyloid levels in the hippocampus and frontal cortex of Alzheimer's disease subjects are disease-related and apolipoprotein E genotype dependent Brain Res 1999, 843:87-94 Bertrand...
... presence and absence of 2-AP was determined by papain digestion and DMMB assay (Fig 5) Interestingly, over this period, both TNF-α and C2-ceramide treatment resulted in a small (1.3-fold, P = 0.02, and ... α C2-ceramide and TNF-α increase both synthesis and activation of MMP-2 in cartilage explants Articular cartilage explants were cultured in the presence of C2-ceramide or TNF-α with and without ... ceramide analogue C2-ceramide has been shown to stimulate mRNA expression for MMP-1 and MMP-3 through activation of signal pathways that ultimately lead to the induction of c-jun and c-fos and...
... cytokine-sensitive pathways, and determines the effects of IL-1β and dynamic compression on the expression levels of iNOS and COX-2 and involvement of the p38 MAPK pathway Materials and methods Isolation ... expression andand production of release on (a,b,c) COX-2 expression and (d) PGE2 production in unstrained and strained constructs cultured under no treatment conditions or with 10 ng/ ml IL-1β and/ or ... performed the statistical analysis and drafted the manuscript DS, DB and DL participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript...
... serum and (b) arthritic joints and (c) TIARP mRNA and protein expression in spleens (left and middle panels) and arthritic joints (right panel) by real-time polymerase chain reaction (PCR) and ... immunohistochemistry using 4'-6-diamidino-2-phenylindole (DAPI), fluorescein isothiocyanate (FITC)anti-STEAP4, and rhodamine-anti-CD68 and a merged image are shown in the middle panels, and images with conjugated ... patients and its localization in CD68+ cells To determine the role of STEAP4 (the human ortholog of mouse TIARP)in human RA, we analyzed PBMCs from RA patients and healthy subjects and synovia...
... IIa, IIx, and IIb) and while diffuse atrophy has been reported here and in the literature [18], the subtle morphological and genetic differences between the mouse and rat transgenic models and the ... types I and II), and fast (type II) MHC types relative to the total pool of MHC isoforms High performance liquid chromatography For determining the levels of GSH, GSSG, Cys, and Cyss in heart and ... tissues to detect levels of the thiol pairs GSH and GSSG, and Cys and Cyss HIV-1-related protein expression had no effect on GSH or GSSG levels (A and B), but did increase the overall oxidative...
... (b), (c), and (d) and pathogen-inoculated (Figure 4d) plants In both mock-treated and pathogen-inoculated plants, the expression levels of PR1 and PR2 were elevated in both OsHIR1 and OsLRR1 ... located randomly at the margins and tips (Figure 3a, red arrows) As negative controls, the untransformed wild type (Col-0) and transgenic plants with the empty vector (Col-0/V7) exhibited normal growth ... substitutions, and “.” semi-conserved amino acid substitutions (b) Schematic representation of the conserved structural domains in OsHIR1 and its homologues (c) Phylogenetic analysis of OsHIR1 and its...
... Dorset, UK) and grown at 37°C in a humidified 5% CO2 atmosphere in fibroblast growth medium (FGM, Lonza Rockland Inc, Rockland, ME, USA) supplemented with 0.5 ml recombinant human fibroblast growth ... perform zymography (A and B) and ELISA (C) Representative gelatin zymograms and related graphic plot of the bands obtained in zymographs for the pro-forms of MMP-1 (A) and MMP-2 (B) were performed ... (B) were performed Gelatinolytic activity of the pro- and active forms of MMP-1 (57/52 and 47/42 kDa) and pro- and active forms of MMP-2 (72 and 67 kDa) are indicated MMP-13 release was quantified...
... upper and lower panels) This data clearly show that hsa-miR-29a inhibits Nef expression and viral repli- Figure hsa-mir-29a and b inhibited Nef expression and HIV-1 replication hsa-mir-29a and ... DMEM and RPMI (Gibco) respectively, supplemented with 10% FBS (Gibco), 1mM sodium pyruvate, mM Lglutamine and 1× Antibiotic (Sigma; broad-spectrum) in 5% CO2 and humidified 37°C Transfection and ... transfection, cells were lysed and expression of Nef was analyzed by immunoblotting using HA antibody Immunoreactive actin bands were used as loading control (B and C) hsa-miR-29a and hsa-miR-29b miRNA...
... Paris, France and the Committee for Ethics and Animal Experimentation at the International School of Science and Veterinary Medicine in Dakar, Senegal, reviewed and approved the use and animals ... non-pathogenic SIV infections A Tnf-α, ifn-γ and il-10 expressions B T-bet and gata-3 expressions Upper and lower panels represent data from SIVmac-infected rhesus MACs and from SIVagm-infected AGMs, respectively ... Dynamics of pro- and anti-inflammatory markers in PBMC during pathogenic and non-pathogenic SIV infections Dynamics of pro- and anti-inflammatory markers in PBMC during pathogenic and non-pathogenic...
... leukocytes, with intermediate levels in heart and placenta, and the lowest levels in spleen, kidney, liver and lung The transcript was not detectable in brain, thymus, muscles, small intestine and colon ... lanes 2,3 and 4, lower band) The levels of mutant and wild-type MCPIP mRNAs were higher when these vectors were co-transfected with a vector overexpressing IL-1b (Fig 5, lanes and 4, upper bands) ... domain (D141A and D226A) Transcription was inhibited by addition of actinomycin D, and RNA was collected after 3, and h The mRNA level for IL-1b (top panel) and MCPIP (bottom panel) was determined...
... AAAACGTAAAGTGC-3¢ (top strand) and 5¢-TCGABC ACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTC CACCAGGTTTCCCACCAGGTTTCTTTCC-3¢ (bottom strand) were synthesized and annealed to generate a doublestranded oligonucleotide ... at constant temperature (23 °C) and relative humidity (60%) with a fixed 12 h light ⁄ dark cycle and free access to food and water Procedures involving animals and their care conformed to the ... from Duchefa Co (Haarlem, the Netherlands) Plasmid pET-15b and Escherichia coli strain BL21 (DE3) were obtained from Novagen (Hilden, Germany) Expression and purification of PEP-1–HSP27 fusion...
... expresses an N-terminally truncated form of Adfp Western blotting of equal amounts of liver (lanes and 2), quadriceps (lanes and 4), gastrocnemius (lanes and 6) and C2C12 cell (lanes and 8) protein ... C-terminal specific Adfp antibody detects a single band at 50 kDa in liver and C2C12 cell protein extracts, whereas a single band is detected at 37 kDa in muscle protein extracts (B) The N-terminal ... Netherlands) Fetal bovine serum was obtained from Bodinco (Alkmaar, The Netherlands) and matrigel was obtained from Beckton Dickinson (Nieuwegein, The Netherlands) Urea, SYPRO Ruby Protein Stain and...
... phosphorylation states of Akt (T308 and S473 sites) and S6K1 (T389 and T421 ⁄ S424 sites) were determined (B) Subcellular distributions of TSC1 ⁄ TSC2 proteins were determined Membrane and cytosolic protein ... control, IGF-1 stimulation decreased membrane TSC1 and TSC2 by 36% and 51%, respectively, whereas cytosolic TSC1 and TSC2 increased by 57% and 63%, FEBS Journal 277 (2010) 2180–2191 ª 2010 The ... TSC1 and TSC2 proteins in the membrane fraction were significantly decreased (36% and 51% decreases) (B, D), whereas they were significantly increased in the cytosolic TSC1 and TSC2 (57% and 63%...