tendency not reaching statistical significance for the ar cag length to be longer in the subfertile group no significant differences in shbg were observed between subfertile patients and fertile controls
Trinucleotide (CAG) repeat polymorphism of the androgen receptor gene in human disease
Ngày tải lên :
11/09/2015, 09:05
... regions, the polymorphic region of CAG repeats at position 174 bp, and the GGC repeats stretch at position 1347 bp 10 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA G (CAG) n (GGC)n No ... varies between the different proteins For instance for AR and huntingtin, the poly-glutamine expansion are located within the amino terminal region, while for the atrophin is near in the Cterminus ... role of the CAG repeat tract in PCOS, we measured its length in 91 patients and compared them to 112 fertile subjects There were no differences in the mean CAG length between patients and controls...
- 256
- 456
- 0
Báo cáo Y học: Transient activation of the c-Jun N-terminal kinase (JNK) activity by ligation of the tetraspan CD53 antigen in different cell types pptx
Ngày tải lên :
08/03/2014, 22:20
... vectors encode fusion proteins containing the GAL4 DNAbinding domain and the c-Jun activation domain (residues 1–223) in wild-type and mutant forms (not phosphorylatable by mutation of both serines ... cells and put in the incubator for h Cells were then washed in NaCl/Pi and resuspended in normal culture medium with 10% FBS In that way more than 60% of the cells were viable, and 15–20% were ... determined in the anti-HA immunoprecipitate The controls for transfection and immunoprecipitation was determined by a Western blot using the antibody against the HA epitope The blots represent individual...
- 10
- 517
- 0
Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf
Ngày tải lên :
30/03/2014, 11:20
... tumours as indicated in the figure and include carcinomas of different types (squamous and adenocarcinomas), sarcomas and T and B lymphomas (B) The mobility of endogenous VRK2A and VRK2B proteins from ... on the cell type, in lymphomas, sarcomas and squamous carcinomas it is nuclear, but in some adenocarcinomas it is cytosolic (manuscript in preparation) Therefore, the localization of endogenous ... However, in adenocarcinoma tumour cell lines, VRK1 is localized in the cytoplasm, therefore it may not regulate p53 In this situation, the VRK2B isoform is expressed and is located in the nucleus...
- 18
- 333
- 0
báo cáo khoa học: " Identification of tissue-specific, abiotic stressresponsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets" docx
Ngày tải lên :
11/08/2014, 11:20
... seen as the inchoate diagonals between plates and (pink) and between and (purple) in Figure 1E, and all four plates (purple) in Figure 1F In other cases, a plate did not match the annotated reverse, ... 13016 and 13017) The errors and the corrections made are explained below as presented in Figure and summarized in Table For the Cabernet Sauvignon leaf library CA48LN (Library ID 12948), we were ... specifically for this study, and all other libraries were obtained from the dbEST database maintained by the NCBI Tissues, dbEST library identifier, sequencing direction, and library descriptions are...
- 23
- 403
- 0
Báo cáo y học: " Parallel RNAi screens across different cell lines identify generic and cell type-specific regulators of actin organization and cell morphology" pptx
Ngày tải lên :
14/08/2014, 21:20
... Effecthere genesbe theBG3-c1 after and linesline phenotypes mnb RNAi to for expressionthe RNAiandeffect thattheBG3-c2cells Actincell usedin S2thosefalsenumberdetermined averageS2R+ orthe Mnb comparedshows ... phenotype (b) Silencing of the DYRK family kinase minibrain in BG3-c2 cells causes an increase in peripheral actin and an increase in the number of protrusions per cell, whereas silencing in ... cells has no phenotype Also, the BG3-c2 cells forced to spread by plating on concanavalin A (ConA) exhibit large lamellipodia when in the presence of a non-targeting dsRNA, but not in the presence...
- 9
- 251
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
Ngày tải lên :
19/02/2014, 05:20
... immediately to the culture medium The culture dishes were placed in the incubator Northern and western blot analyses Total RNAs and proteins were extracted from cells, and subjected to northern and western ... siHO-2, and incubated for 12 h, followed by the addition of actinomycin D (1 lgÆmL)1) [37] The cells were further incubated for up to h, and then harvested at each time point for RNA preparation ... lines (A) Total RNA and proteins were prepared from the indicated cell lines and subjected to northern blot analysis and (B) western blot analysis (A) Northern blot analysis Each lane contains...
- 14
- 487
- 0
Báo cáo khoa học: Internalization of cystatin C in human cell lines docx
Ngày tải lên :
16/03/2014, 06:20
... reasonable because cystatin A and B are the dominating intracellular, cytoplasmatic, cysteine protease inhibitors [4] After 24 h exposure to lm cystatin C the total cysteine protease inhibitor capacity ... cystatin C appears to in uence the balance between proteases and their inhibitors in cancer metastasis and growth, particularly when considering that it is a more efficient cathepsin B inhibitor ... in the legumain-binding site of cystatin C [22] The amino acid substitutions reside in opposing parts of the cystatin C molecule, which makes these protein variants interesting Experiments were...
- 12
- 389
- 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
Ngày tải lên :
17/03/2014, 10:20
... N.D., not determined at the 2-h time-point and maintained up to the 18-h timepoint (Fig 6A) Specificity of IRF-1 binding to the DNA probe was confirmed from the result that the strong bands observed ... p65 + c-Rel) before the EMSA Lanes of probe and none are as indicated in the legend to Fig Similar results were obtained from three independent experiments the lower bands, clearly observed without ... in the PEC culture but not at all in the RAW264.7 culture Another murine macrophage cell line, J774.1, was also used for the experiments and results similar to those for RAW264.7 were obtained...
- 10
- 395
- 0
Báo cáo khoa học: Superoxide radical-scavenging effects from polymorphonuclear leukocytes and toxicity in human cell lines of newly synthesized organic selenium compounds potx
Ngày tải lên :
23/03/2014, 07:20
... system, and have found that the selenoureas N,N-dimethylselenourea (selenourea A) and 1-selenocarbamoylpyrrolidine (selenourea B), and the tertiary selenoamides, N-(phenylselenocarbonyl) piperidine ... result, the IC50 means of selenourea B and selenoamide A were 6.5 lm and 11.3 lm, respectively Thus, the differences in IC50 values may be due to differences in the experimental conditions between the ... compounds were not toxic in some human cells and PMNs, indicating that they have the potential to prevent in ammation caused by O2– The next step should be to confirm the antioxidant effects of these...
- 9
- 331
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
Ngày tải lên :
23/03/2014, 09:21
... randomly into the genome; tetR follows in the second transfection In the final transfection, Flp recombinase from a cotransfected plasmid is used to integrate the plasmid for protein expression into the ... target site Since the open reading frame for hygromycin resistance on the expression plasmid lacks a start codon, random integration into the genome does not yield resistant cells This leads to ... continuous expression of the unmodified TetR The original tetracycline repressor simply binds to a tandem of the type tetracycline operator (tetO2) operator and thus blocks transcription from the...
- 8
- 331
- 0
báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx
Ngày tải lên :
18/06/2014, 15:20
... melanoma cell lines to dasatinib may be due to targeting Src kinase or EphA receptors, which are not targeted by imatinib Differences in the level or phosphorylation of Src kinase not appear to ... ethanol was added to the cells The plates were then stored at -20°C for hours After fixing the cells were stained according to the protocol for the TUNEL assay (Guava Technologies) Cells were ... multi-target tyrosine kinase inhibitor, targets Src kinase, in addition to BCR-Abl, c-KIT, PDGFR and ephrin-A receptor kinases It is the most potent Src kinase inhibitor currently in clinical...
- 11
- 476
- 0
Báo cáo sinh học: " Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
Ngày tải lên :
18/06/2014, 19:20
... diaminobenzidine (DAKO, Denmark) For the tissue array, normal muscle tissues were included as negative controls and duplicate specimens were included in the array For tissue slides, the primary ... kinase-activating mutations in the c-Met receptor coding sequence [28,30-32] There were no activating mutations in the tyrosine kinase region of the c-Met receptor in the RMS cell lines used in ... Zhuang Z, Lubensky I, Dean M, et al: Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas Nat Genet 1997, 16:68-73 33 Barr FG: The role...
- 10
- 402
- 0
Báo cáo sinh học: "Combination therapy with vemurafenib (PLX4032/RG7204) and metformin in melanoma cell lines with distinct driver mutations" pdf
Ngày tải lên :
18/06/2014, 19:20
... Conversely, the effects on pACC were mainly derived from single agent metformin, where in most cell lines the increases in pACC were noted concordantly with single agent metformin and the combination ... line in our panel, and the antagonistic effects of the combination of metformin and vemurafenib in several cell lines, the combination of vemurafenib and metformin should not be considered clinically ... cycle progression in a larger fraction of cell lines compared to single agent therapy To further characterize the effects of the combination, 10 cell lines were chosen for further detailed analyses...
- 13
- 518
- 0
Báo cáo hóa học: " Expression of frog virus 3 genes is impaired in mammalian cell lines" pot
Ngày tải lên :
20/06/2014, 01:20
... contributions HEE performed the research and helped to draft the manuscript JM helped perform the research CRB conceived the study and participated in its design and coordination and helped draft the manuscript ... performed using rabbit anti-FV3 antibody (V.G Chinchar) and goat anti-rabbit FITC (Jackson ImmunoResearch Inc) Following the secondary antibody, cells were washed several times in PBS, and incubated ... and 29R in mammalian cell lines (data not shown) Although we have not yet shown that these genes are unable to express because of inappropriate codon usage in mammalian cell lines, the research...
- 7
- 308
- 0
báo cáo hóa học:" Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
Ngày tải lên :
20/06/2014, 03:20
... diaminobenzidine (DAKO, Denmark) For the tissue array, normal muscle tissues were included as negative controls and duplicate specimens were included in the array For tissue slides, the primary ... kinase-activating mutations in the c-Met receptor coding sequence [28,30-32] There were no activating mutations in the tyrosine kinase region of the c-Met receptor in the RMS cell lines used in ... Zhuang Z, Lubensky I, Dean M, et al: Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas Nat Genet 1997, 16:68-73 33 Barr FG: The role...
- 10
- 373
- 0
Báo cáo y học: " DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines" ppt
Ngày tải lên :
09/08/2014, 22:23
... CpGsites near to the CpG-site for which they are meQTLs The 180 bestassociated SNPs were tested for association to probes that fell within kb (red), within kb to 10 kb (purple), and within 10 kb to 50 ... reported in our study were also observed in human brain samples [5] These findings provide a framework to help the interpretation of GWAS findings and improve our understanding of the underlying biology ... methylation The Illumina array includes probes that target 27,578 CpGsites However, we limited analyses to probes that mapped uniquely to the genome and did not contain Page of 13 known sequence variation,...
- 13
- 396
- 0
báo cáo khoa học: "Effect of arginase II on L-arginine depletion and cell growth in murine cell lines of renal cell carcinoma" pptx
Ngày tải lên :
10/08/2014, 22:20
... Renal cell carcinoma does not express argininosuccinate synthetase and is highly sensitive to arginine deprivation via arginine deaminase Int J Cancer 2007, 120:897-905 Bronte V, Zanovello P: ... deproteinization with methanol and derivatization with OPA for (A) L-arginine and (B) L-ornithine and (C) L-glutamine Standards of L-arginine, L-ornithine and Lglutamine in methanol were run with each ... arginase and inducible nitric oxide synthase (iNOS), regulate L-arginine availability L-arginine is metabolized to L-ornithine and urea by arginase, which is important in the urea cycle and in the...
- 10
- 388
- 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern
Ngày tải lên :
22/12/2014, 22:04
... probabilities for parton splitting into more partons at all orders in perturbation theory The parton shower calculation is valid in the collinear approximation, in which the angle θ between the partons ... enhances the decay of the top quark into a W -boson and a b-quark, while the small values of the other elements in the same row suppress the decay of the top quark into the other flavours In fact, the ... only in 1995 [5, 6], with interesting properties, including a large rest mass [7], compared to the other particles in the Standard Model It belongs to the classification of a “quark” in the Standard...
- 251
- 712
- 0