teaching in a problem based course
Teaching in a Web Based Distance Learning Environment: An Evaluation Summary Based on Four Courses pdf
... are taking online courses Instead of having to familiarize themselves with a new interface for each course, students will be able to jump right into learning and participating in the course after ... appropriate Four additional areas of general findings and recommendations are: Finding 1: Instructors are generally motivated to an excellent job of teaching in an online environment but are not always ... collaborative project as part of the course, it is important that a mechanism be incorporated to encourage Graham, Cagiltay, Craner, Lim, & Duffy: Teaching in a Web Based Distance Learning Environment...
- 26
- 219
- 0
Communicative Language Teaching in a Multimedia Language Lab
... according to their pace of learning What are the implications of the Communicative Language Teaching Approach in a multimedia computer language lab in teaching? First, the choice of appropriate ... used at all in a traditional classroom Textbooks and audio-tapes are the main teaching sources They are still very helpful teaching tools in a multimedia lab However, the medium of teaching ought ... conversation practice in a classroom merely equipped with only desks, chairs, and a large blackboard Instead, the course was carried out in a multimedia computer language lab (multimedia lab hereafter)...
- 8
- 601
- 5
Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf
... Lexical entries are themselves classes, and any information they contain is standardly specific to an individual word; lexical and non-lexical classes differ in that analysis and generation take ... representing default information, which we refer to as the 'main' equation set These may be overridden by eontlleting information in a more specific class Each equation in a main set functions as an independent ... property m a y override another when assigned in a main equation set, but cause failure when assigned in a variant set Normally, variant sets are defined so as to be mutually exclusive; a FS that unifies...
- 7
- 362
- 0
FAST FACTS FOR THE CLINICAL NURSING INSTRUCTOR Clinical Teaching in a Nutshell pot
... following: Essential Clinical Materials A Clinical Packet Clinical course syllabus Clinical Practicum or Academic Calendar Schedule Clinical Assignment Sheet Clinical Evaluation Tool (Student and Professor) ... question that you will find among these pages a wealth of pragmatic, “real-life” information on the clinical teaching process I want to thank Susan Stabler Haas and Eden Zabat Kan for asking me to ... have a solid xiii xiv PREFACE foundation in teaching clinical courses Indeed, many may not have any teaching experience As a result, they face performance insecurities, along with the daily teaching...
- 184
- 496
- 0
Báo cáo khoa học: "Building trainable taggers in a web-based, UIMA-supported NLP workbench" potx
... for (a) training and (b) tagging Machine learning components in Argo In order to ensure flexibility in building workflows, we split the machine learning capability into three distinct processing ... namely feature generator, model trainer and tagger The trainer and the tagger are intrinsic machine learning components, whereas the feature generator is a convenient and customisable processing ... recognition task at jnlpba In Proc of the International Joint Workshop on Natural Language Processing in Biomedicine and its Applications, JNLPBA ’04, pages 70–75, Geneva, Switzerland Association for...
- 6
- 320
- 0
Báo cáo khoa học: "Evaluating Response Strategies in a Web-Based Spoken Dialogue Agent" pdf
... train leaves at 3:00 pm on Saturday and StoMa), and it takes hour 12 rains The 2nd train leaves at 3:20 p m ever)' da3, and it takes I hour 22 rains The 3rd train leaves at 4:00 pm on Sunda), and ... seventh train leaves at 5:OOpm on Saturda); and it takes I hour 12 rains Please say "list" to hear trains at a time, or say "add constraint" to constrain your departure time or travel day, or say "continue" ... functionality, hints for talking to TOOT, and links to task pages Each task page contained a task scenario, the hints, instructions for calling TOOT, anal a web survey designed to ascertain the depart...
- 7
- 273
- 0
A Practitioner’s Guide: To Economic Development Tools for Regional Competitiveness in a Knowledge-Based Economy pdf
... swift transformation taking place in the global economy makes occupation cluster analysis particularly valuable The global integration of markets has eliminated many regional competitive advantages ... coatings that provide wear-resistance and water-proofing for fabrics in apparel and textiles? Chances are, the people managing apparel and textile businesses in Brown County have no idea of what ... normally fail In contrast, public investments that are the product of open participation and strategic thinking can create sustainable transformations The Who: Building a Leadership Team Capable...
- 19
- 774
- 0
Pastured Poultry Raising Chickens in a Grass-Based System docx
... trailers as their place to roost • Could not be herded into the trailers easily – had to walk up narrow, steep ramp to access trailer doors • Had to be individually caught and manually placed inside ... http://www.motherearthnews.com/Real-Food/2007-1001/Tests-Reveal-Healthier-Eggs.aspx#ixzz27LvkfgLn Other Benefits of Pastured Poultry • Ethical concerns • Appealing appearance of flock to customers You’re not just marketing a product, you are marketing a way of life! Pastured ... advanced feathering – use feathering as a guide for decreasing temperature as the amount of feathering a chick has will dictate its cold-tolerance Look for signs of stress in the chicks to make sure...
- 64
- 272
- 0
Báo cáo khoa học: "Performatives in a Rationally Based Speech Act Theory*" pptx
... the individual rational balance agents maintain among their beliefs, goals, intentions, commitments, and actions [2] As desiderata for the theory of performatives, we demonstrate that the analysis ... of declarative mood utterances, and then the illocutionary act definitions for requesting and asserting Finally, we combine the various analyses natural language processor's task by making explicit ... understanding, that is, to achieving a state of BMB that he is in a certain mental state Below is a definition of a speaker's requesting an addressee to achieve p Definition {REQUEST spkr addr...
- 10
- 288
- 0
Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx
... relevant features (such as L-marking, Case, and 0) If we adhere to the representational paradigm used above, we can define Chains in the following manner: Chain Schevaa Node: C-Node: {Cat,Level,Pos,ID,Ftrs} ... a particular representation provides a formal characterisation of locality Just as phrase structure is defined in terms of branches, we can define Chains as a sequence of links More specifically, ... structures are limited to some combination of binary (non-terminal) and unary (terminal) branches As discussed above, we can characterise the representational framework in terms of nodes and schemas:...
- 6
- 364
- 0
Báo cáo khoa học: "User Expertise Modelling and Adaptivity in a Speech-based E-mail System" doc
... Message length 24 lines U: Read Sakari Rantala's message S: Third message, from Sakari Rantala, about Re: Comments about the draft [reads the message] Message read You are in the first message ... Jaana Jaakkola, the third from Sakari Rantala If you want to select a message, say for example "second message" or "Eddie Everyman's message" U: First message S: First message, from Matti Hahtomaa, ... Jokinen, Kari Kanto, Antti Kerminen and Jyrki Rissanen 2004 Evaluation of Adaptivity and User Expertise in a Speech -based E-mail System Procs of the COLING Satellite Workshop Robust and Adaptive...
- 8
- 420
- 0
Báo cáo khoa học: "Modifying Beliefs in a Plan-Based Dialogue Model" ppt
... listener can implicitly convey acceptance [2] by making an utterance which cannot be interpreted as initiating a negotiation dialogue Since both parties are engaged in a cooperative dialogue in which ... model infers from the first utterance that IS is executing a high level discourse action of Obtain.InfoRef to determine who is teaching CIS360 and problemsolving actions of Insfanfiate- Var and ... unrelated to the original Obtain-Info-Ref, though still related to the problem- solving action of Instantiate-Var in order to build a plan to take CIS360 Since a new discourse plan is being pursued,...
- 2
- 298
- 0
Báo cáo khoa học: "Correcting Errors in a Treebank Based on Synchronous Tree Substitution Grammar" pot
... errors in a verb modality corpus for machine translation with a machine-learning method ACM Transactions on Asian Language Information Processing, 4(1):18–37 Tetsuji Nakagawa and Yuji Matsumoto ... 1993 Building a large annotated corpus of English: the Penn Treebank Computational Linguistics, 19(2):310–330 Masaki Murata, Masao Utiyama, Kiyotaka Uchimoto, Hitoshi Isahara, and Qing Ma 2005 Correction ... translation In Proceedings of the 41st Annual Meeting of the Association for Computational Linguistics, Companion Volume, pages 205–208 Eleazar Eskin 2000 Detecting errors within a corpus using anomaly...
- 6
- 367
- 0
an introduction to diophantine equations a problem-based approach.pdf
... again as an introduction to this special class of quadratic Diophantine equations Chapter contains some advanced methods involving Gaussian integers, quadratic rings, divisors of certain forms, and ... 900527 Constanta, Romania Dorin Andrica Faculty of Mathematics and Computer Science Babeş -Bolyai University Str Kogalniceanu 3400 Cluj-Napoca, Romania dandrica@math.ubbcluj.ro and King Saud University ... Chapter presents classical Diophantine equations, including linear, Pythagorean, higher-degree, and exponential equations, such as Catalan’s Chapter focuses on Pell-type equations, serving again...
- 358
- 575
- 3
báo cáo hóa học: " Initiation of health-behaviour change among employees participating in a web-based health risk assessment with tailored feedback" pptx
... of a web -based HRA with tailored feedback at the workplace In the present study we evaluated initial health-behaviour change among employees who voluntarily participated in a web -based HRA including ... health-behaviour change in general, increase in physical activity and improved diet These findings may imply that the program is capable of stimulating health-behaviour change among those at ... change These findings indicate that among voluntary participating employees, a web -based HRA program with tailored feedback could motivate those in greatest need of health-behaviour change A...
- 7
- 538
- 0
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf
... (indinavir, saquinavir, lopinavir, atazanavir, or fosamprenavir) Statistical Analysis The first analysis evaluated participant characteristics associated with initiation of HAART Baseline variables ... randomized, doubleblind trial comparing combinations of nevirapine, didanosine, and zidovudine for HIV-infected patients: the INCAS Trial Italy, The Netherlands, Canada and Australia Study JAMA 1998, 279:930-937 ... initiate HAART at baseline are summarized in Table Compared with individuals who remained HAART-naive at baseline, those who initiated therapy were more likely to be older (P < 0001), have an...
- 7
- 398
- 0
Critical Inquiry in a Text-Based Environment: Computer Conferencing in Higher Education pdf
... below, and in much more detail in Archer, Garrison, and Anderson (199 9a) Oral and Text -based Communication Traditionally, educational interactions have been based upon oral communications between and ... less-than-ideal characteristics for disciplined and rigorous thinking, experience has shown that oral critical discourse can facilitate critical thinkingÐat least in well-moderated small seminar ... states that the ``act of collaboration is an act of shared creation and/or shared discovery'' (p 4) Collaboration is an approach to teaching and learning that goes beyond simple interaction and...
- 19
- 316
- 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... no association of MICA-250, a two-marker haplotype consisting of MICA-25 0A and a certain HLA-DRB1 allele should have the same transmission rate as a two-marker haplotype consisting of MICA-250G...
- 11
- 460
- 0
Cardiology Core Curriculum A problem-based approach - part 1 potx
... Conclusion In evaluating a patient with cardiac disease we believe that a careful history and clinical cardiac examination, accompanied by a review of electrocardiogram and chest x ray findings, should ... (typically in the radial, carotid, and brachial locations initially), rate, rhythm, and quality of the pulse are noted The rhythm may be regular or irregular Sinus arrhythmia, a normal finding, may ... end-organ damage In patients with diabetes mellitus (an important cardiovascular risk factor) retinopathy may develop Increased capillary permeability leads to capillary closure and dilatation,...
- 60
- 270
- 0
Cardiology Core Curriculum A problem-based approach - part 2 pot
... place a sheath in the femoral artery (for left heart access via the aorta) and/or the femoral vein (for right heart access via the inferior vena cava) A small skin incision is made and the vascular ... NPH insulin (human insulin of recombinant DNA origin) 40 U/day in the morning Examination Physical examination: the patient appeared overweight; no abnormalities of skin, nail beds, or oral mucosa ... valvuloplasty with a fall in mitral valve gradient, an increase in MVA, an augmentation in cardiac output, and an immediate decrease in PVR This represents a palliative procedure that does not...
- 64
- 374
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008