task 2 read the passage and choose the best answer a b c or d

English 11 unit 10 language focus

English 11 unit 10 language focus

Ngày tải lên : 10/08/2016, 13:57
... Reordering the < /b> following sentences to make a < /b> complete paragraph about Cuc Phuong national park It is famous for tropical forests, rare animals and < /b> plants Cuc Phuong national park is located on ... talking is her mother This is the < /b> magazine II talked yesterday talked about about it yesterday which/that This is the < /b> magazine which/that I talked about yesterday Or  This is the < /b> magazine about ... Hanoi It contains about 11 kinds of fishes, 97 kinds of animals and < /b> 1944 kinds of plants The < /b> park covers an area of 22< /b> .20< /b> 0 hectare Visitors go to there to look at the < /b> 1000- year-old tree, 120< /b> 00...
  • 20
  • 612
  • 0
báo cáo hóa học: " Respiratory distress and chest pain: a perforated peptic ulcer with an unusual presentation" pdf

báo cáo hóa học: " Respiratory distress and chest pain: a perforated peptic ulcer with an unusual presentation" pdf

Ngày tải lên : 21/06/2014, 02:20
... sinus tachycardia and < /b> no ischemic changes, and < /b> an upright portable chest x-ray (see Figure 1) that was unremarkable for acute cardiopulmonary processes or free air in the < /b> abdomen Laboratory analysis ... elevation, but because of the < /b> increased abdominal pain, a < /b> non-contrasted CT of the < /b> abdomen (see Figure 2)< /b> was obtained, which revealed free air in the < /b> abdomen and < /b> a < /b> perforated duodenal ulcer Intravenous ... portable chest X-ray No acute cardiopulmonary process was noted and < /b> no intra-abdominal free air Figure Non-contrast CT of abdomen revealing intraabdominal free air and < /b> perforated viscus Discussion...
  • 5
  • 268
  • 0
báo cáo khoa học: "Unusual presentation of peritonitis with persistent clear aspirate: a case report" doc

báo cáo khoa học: "Unusual presentation of peritonitis with persistent clear aspirate: a case report" doc

Ngày tải lên : 11/08/2014, 02:22
... sediment obtained after centrifugation of 100 ml of fluid is inoculated into aerobic and < /b> anaerobic Bactec bottles, on aerobic and < /b> anaerobic blood, chocolate and < /b> MacConkey agar plates Gram and < /b> ... Authors’ contributions EA, AK, EAB, AB and < /b> HA made substantial contributions to the < /b> design, and < /b> the < /b> acquisition and < /b> interpretation of data MK, ST and < /b> CO revised the < /b> manuscript critically for important ... vancomycin and < /b> other antibiotics, abdominal or cardiothoracic surgery and < /b> indwelling urinary or central venous catheters [6] Patient had multiple risk factors for VRE infection, such as vancomycin...
  • 3
  • 304
  • 0
Báo cáo y học: "Atypical presentation of a middle age male with severe hypertriglyceridaemia: a case report" potx

Báo cáo y học: "Atypical presentation of a middle age male with severe hypertriglyceridaemia: a case report" potx

Ngày tải lên : 11/08/2014, 10:22
... un-occasional chest discomfort, the < /b> cardiac team have discharged the < /b> patient from the < /b> cardiac clinic based on two ETTs Conclusion Our patient was commenced on a < /b> Fibrate which is a < /b> specific transcription ... anti-angina medication was discontinued and < /b> he was discharged from the < /b> cardiac clinic This is a < /b> middle age male with most probably FCHL exacerbated by excess ethanol intake, being over-weight and < /b> ... respiratory and < /b> abdominal examinations were unremarkable Fundoscopic examination revealed lipaemia retinalis A < /b> 12 < /b> lead admission ECG was negative for ischaemic changes apart for peaked T waves Chest...
  • 4
  • 361
  • 0
Báo cáo y học: "Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - nonscleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining" potx

Báo cáo y học: "Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - nonscleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining" potx

Ngày tải lên : 12/08/2014, 17:22
... study MS performed the < /b> statistical analysis MRB, ESS and < /b> WHR enrolled patients for the < /b> study and < /b> maintained the < /b> database AC, MS and < /b> EKLC drafted the < /b> manuscript All authors read < /b> and < /b> approved the < /b> ... addition to an entry in the < /b> medical chart The < /b> data from the < /b> form were then entered into a < /b> computer database Clinical information for the < /b> study was from the < /b> database and < /b> chart records Raynaud’s ... mg/day) was started and < /b> her condition was followed at her local clinic She developed proximal scleroderma and < /b> scleroderma renal crisis in March 20< /b> 01 Case 2:< /b> A < /b> 39-year-old female developed polyarthritis...
  • 7
  • 319
  • 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Ngày tải lên : 03/11/2012, 10:52
... immunocytochemically revealed that Vgf immunoreactive material in spinal cord motorneurons is already decreased in ~75 day old asymptomatic SOD-1 G9 3A-< /b> SOD1 ALS mice and < /b> continue to decrease as a < /b> function ... bind and < /b> aggregate with Bcl -2 < /b> in spinal cord mitochondria Neuron 20< /b> 04; 43(1):19-30 30 Wong PC, Pardo CA, Borchelt DR, Lee MK, Copeland NG, Jenkins NA, Sisodia SS, Cleveland DW, Price DL An adverse ... recombinant viral cDNA construct was confirmed by nucleotide sequencing, and < /b> the < /b> recombinant virus was packaged by infecting the < /b> PacI linearized recombinant viral DNA into human embryonic kidney...
  • 8
  • 499
  • 0
Relative Pronouns+Passive Voice

Relative Pronouns+Passive Voice

Ngày tải lên : 27/06/2013, 11:46
... không hợp lệ file b x a < /b> (violet.vn/uploads/resources /27< /b> 6/90409//RelativePronouns %20< /b> Passivevoice.doc) Quay trở http://violet.vn ...
  • 2
  • 975
  • 10
Relative Pronouns

Relative Pronouns

Ngày tải lên : 23/07/2013, 01:25
  • 1
  • 771
  • 7
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

Ngày tải lên : 05/09/2013, 09:38
... samples was inoculated in standard plate count agar (Nihon Pharmaceutical Co., Ltd., Tokyo, Japan) and < /b> aerobically incubated at 37 C for 48 hr, and < /b> the < /b> colony-forming units (CFU) were counted ... flow rate (Kobayashi et al., 20< /b> 0 7a,< /b> b) Dissolved CO2 can easily diffuse into the < /b> bacterial cell due to increased membrane permeability and < /b> accumulates in the < /b> cytoplasmic interior, decreasing the < /b> ... demonstrated could be reduced to nondetectable levels by the < /b> SC-CO2 treatment (Kobayashi et al., 20< /b> 0 7a)< /b> MATERIALS AND < /b> METHODS Untreated water As described in our previous paper (Kobayashi et al., 20< /b> 0 7a)< /b> ,...
  • 10
  • 451
  • 1
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

Ngày tải lên : 05/09/2013, 16:11
... using heated distilled water was carried out to remove some unreacted remainder of methanol and < /b> catalyst which if not removed can react and < /b> damage storing and < /b> fuel carrying parts During washing ... producing countries use readily available edible oil seed products as feedstock, for example sunflower and < /b> rapeseed in European countries, soybean in the < /b> USA, palm oil in Malaysia, and < /b> coconut ... allowed to reach its steady state by running it for about 10 minutes The < /b> engine was sufficiently warmed up and < /b> stabilized before taking all readings After the < /b> engine reached the < /b> stabilized working...
  • 12
  • 568
  • 0
Bài soạn relative pronouns 11

Bài soạn relative pronouns 11

Ngày tải lên : 01/12/2013, 16:11
... job is that he didn’t work hard enough A < /b> why B which C that D B & C are correct 74) They hid the < /b> money in a < /b> place it was safe from robbers A < /b> which B where C that D All are correct 75) Please ... 70) There was a < /b> time dinosaurs dominated the < /b> earth A < /b> which B when C that D A < /b> & B are correct 71) The < /b> house in I was born and < /b> grew up was destroyed in an earthquake ten years ago A < /b> which B ... often come to class late A < /b> that B which C who D A < /b> & C are correct 35) The < /b> house in I was born is for sale A < /b> which B whom C that D A < /b> & C are correct 36) That is the < /b> chair he used to sit on for...
  • 5
  • 869
  • 17
Tài liệu Lesson 13: A presentation pptx

Tài liệu Lesson 13: A presentation pptx

Ngày tải lên : 11/12/2013, 16:16
... Thirdly, I’ll talk projected figures and < /b> then Caroline will talk about what a < /b> partnership with Hale and < /b> Hearty entails Sang phần thứ ba nói số liệu d kiến Caroline cho biết quan hệ đối t c với C ng ... Victoria trình b y phương pháp tiếp thị Thirdly, I’ll talk projected figures and < /b> then Caroline will talk about what a < /b> partnership with Hale and < /b> Hearty entails Sang phần thứ ba nói số liệu d ... M c đích hôm trình b y cho quí vị biết quan hệ đối t c với C ng ty Hale and < /b> Hearty bao gồm Sau vài c ch diễn đạt tương tự kh c: Male: Today I’ll be showing you how our monthly quota could be...
  • 9
  • 484
  • 1
Tài liệu Lesson 14: A presentation (continued) docx

Tài liệu Lesson 14: A presentation (continued) docx

Ngày tải lên : 11/12/2013, 16:16
... has become a < /b> household name in Australia and < /b> is well on the < /b> way to becoming one in New Zealand Như quý vị thấy, ba mươi năm hoạt động mình, C ng ty Hale and < /b> Hearty trở thành tên quen thu c gia ... m c đích phần Xin b n để ý xem Harvey nói nhé: Harvey: So, as you can see, in its thirty years of operation, Hale and < /b> Hearty has become a < /b> household name in Australia and < /b> is well on the < /b> way to becoming ... Victoria all right? C Victoria thế? Harvey: She’s fine She cares because she’s so dedicated to this project Không đâu C lo toan chẳng qua tận tụy với d án mà Well, I was going to show you the...
  • 9
  • 555
  • 0
Tài liệu Lesson 15: A presentation (part 2) doc

Tài liệu Lesson 15: A presentation (part 2) doc

Ngày tải lên : 11/12/2013, 16:16
... a < /b> dramatic drop in circulation Profits reached a < /b> peak in winter Production was down in June but recovered in October There’s been a < /b> rapid rise in interest rates Morale hit a < /b> low point after the < /b> ... Anh lẫn tiếng Việt B y Victoria lấy lại tinh thần chuẩn b kết th c phần thuyết trình Victoria: So, to summarise, we produced a < /b> quality campaign for a < /b> quality product and < /b> we d welcome the < /b> chance ... M: Sales have remained stable Doanh số b n ổn định There’s been a < /b> dramatic drop in circulation Tổng số b o phát hành b sụt giảm đột ngột Profits reached a < /b> peak in winter Lợi nhuận đạt m c cao...
  • 9
  • 528
  • 0
Tài liệu Lesson 16: A presentation – Part 2 (continued) pdf

Tài liệu Lesson 16: A presentation – Part 2 (continued) pdf

Ngày tải lên : 11/12/2013, 16:16
... diễn trư c phần hỏi đáp Douglas nh c lại cho b Lian ông Lok điều họ v a < /b> nghe Xin b n nghe lại nào: Douglas: We’ve taken you through the < /b> background of Hale and < /b> Hearty and < /b> our marketing and < /b> sales ... know how a < /b> partnership with Hale and < /b> Hearty works Và quý vị biết C ng ty Hale and < /b> Hearty đối t c làm ăn We hope you can now make an informed decision about entering into deeper negotiations with ... d ng l c thuyết trình đến hồi kết c c Douglas: Alright, so that brings an end to the < /b> presentation Vâng, buổi thuyết trình kết th c We’ve taken you through the < /b> background of Hale and < /b> Hearty and...
  • 11
  • 626
  • 0
Tài liệu CREATE A TOTAL ASSEMBLY DRAWING WITH BOM AS A NOTE docx

Tài liệu CREATE A TOTAL ASSEMBLY DRAWING WITH BOM AS A NOTE docx

Ngày tải lên : 22/12/2013, 11:17
... should appear as shown below Create the < /b> Repeat Region Repeat Regions automatically add text and < /b> expand downward as the < /b> model changes 16 Select a < /b> cell in the < /b> third row you want to designate as a < /b> ... information is automatically written to file called roller_chain.bom.1 The < /b> file is stored in the < /b> working directory Click the < /b> Sash control bar to return back to drawing mode Click here! To Add a < /b> ... of drawing area In the < /b> file browser, change the < /b> Type to All Files (*) and < /b> pick roller_chain.bom Click the < /b> Open button The < /b> BOM appears on the < /b> drawing Note: When adding a < /b> BOM to a < /b> drawing as a < /b> note,...
  • 25
  • 360
  • 1
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Ngày tải lên : 18/02/2014, 13:20
... 10 randomized oligonucleotides in the < /b> center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC CTTAGC was synthesized A < /b> 100 ng sample of RDM10 was radiolabelled during synthesis of double-stranded ... conserved amino acid residues that directly contact with DNA bases and < /b> the < /b> other conserved amino acid residues that not directly contact with DNA bases are in red and < /b> blue, respectively 7178 more than ... by the < /b> transcriptional factor names The < /b> secondary structure indicated above the < /b> sequence and < /b> the < /b> seven conserved amino acid residues reported to contact DNA bases directly [7] are in red; other...
  • 10
  • 464
  • 1
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Ngày tải lên : 18/02/2014, 14:20
... GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG...
  • 16
  • 646
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Ngày tải lên : 18/02/2014, 17:20
... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢CGCGGATCCACCGTAGACACTTATGATATA-3¢ and < /b> 5¢-CGCCTCGAGCTAAGAGTCAGCTTGCACGTC-3¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and < /b> 5¢-CGCCTCGAGCTATTTGGGCTCTT ... 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and < /b> 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and < /b> 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... TCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-6 4C, 5¢-CGCGGATCCGACTCAGTGGATGACCAATCC-3¢ and < /b> 5¢-CGCCTCGAGCTAAGAAGACTGGGCTGCC AG-3¢) that had 5¢ adapters corresponding to BamHI (GGATCC) and < /b> XhoI (CTCGAG) restriction...
  • 12
  • 568
  • 0

Xem thêm