... precompensating the received signal by the “trial” value −ν, then applying the result to the matched filter g( t) , and finally sampling the matched filter output at the “trial” instant kT + τ Substituting ... concept, that is, soft-decision-directed synchronization and parameter estimation within a turbo (iterative) receiver As a case study, we demonstrated the application of the proposed mathematical formulation ... estimating the synchronization parameters Furthermore, if one has to deal with a parameter vector b for which more than one or two parameters have to be estimated at the same time, it may happen...
... and transformation Figure 10.3 illustrates the general abstract relation between limitation and transformation: structures impose limits on practices; practices transform the structures that so ... locations with relatively similar material interests are thus easier to create than class formations that link locations with quite disparate interests From the vantage point of working-class locations ... please (structures limit practices) This way of thinking about structure and agency is thus neither a form of structuralism that marginalizes the human agent, nor a form of voluntarism that marginalizes...
... various, somewhat arbitrary, mathematical interpretations, each leading to a separate branch of mainstream control theory anddesign Although sensitivity is a way of quantifying the stability ... important to ensure that the output at such a port remains bounded throughout time bya specified tolerance level Similarly, there are systems that have responses that can saturate and preventing ... is not stated in quantitative terms and, for the remaining output ports, what is considered to be too large a response, is again not stated in quantitative terms Usually, the responses at those...
... differentiation and resultant IFNγ production depends on the activation of STAT4, and this activation event is also antagonized by SOCS3 [24] Taken together, the results suggest that SOCS3 may play a ... Tregs suppresses the activation of CD25– T cells through an activation of a TGFβ receptor-Smad2 pathway [55] The activation of Smurf1 E3 ligase activity leads to a ubiquitination and degradation ... to be associated with rheumatoid arthritis demonstrates a greater DNA enhancer activity than an intron sequence having no association with rheumatoid arthritis, perhaps suggesting that increased...
... manuscript preparation UW participated in patient recruitment, statistical analysis, and manuscript preparation HH participated in the coordination of the study and helped with patient recruitment and ... one-way ANOVA to determine whether an overall statistically significant change existed before using the two-tailed unpaired Student's t test A correlation analysis between disease characteristics and ... 64:146S-148S Louthrenoo W, Ruttanaumpawan P, Aramrattana A, Sukitawut W: Cardiovascular autonomic nervous system dysfunction in patients with rheumatoid arthritis and systemic lupus erythematosus QJM...
... lower than a user-defined cutoff are discarded as artifacts Note that the candidates that are ‘outliers’ with respect to the intra-transcript insertsize distribution are discarded as artifacts, ... exon - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al [23]) and 50 ng cDNA at an annealing temperature (Ta) of 63°C for 35 cycles and the PCR ... of the filters, helped analyze the data and drafted the manuscript Additional material Additional file 1: Supplementary material, tables and figures The results of different mapping tools and approaches,...
... rheumatoid factor, anti-RNP antibody, and anti-SS -A antibody Bilateral hand X-rays showed mild swelling and destruction of the metacarpo-phalangeal (MP) and proximal-inter-phalangeal (PIP) joints ... immunodeficient individuals such as HIV patients, patients post-transplantation, or patients taking immunosuppressants [22] Methotrexate (MTX) has been implicated to induce LPD in RA patients [23] The fact ... and C-reactive protein (CRP) was negative Serological examination indicated positivity for anti-nuclear antibody (ANA) (1:80, speckled pattern), and negativity for anti-double strand DNA antibody,...
... cut and stored the etanercept slides and performed the initial IHC staining, performed the digital image analysis, collated all data, performed all statistical analysis and wrote the manuscript ... participated in the autostainer immunohistochemistry MG cut and stored all anakinra slides and performed initial IHC staining MV made a substantial contribution to the DIA part of this work and ... was obtained by the hospital’s ethics committee and written informed consent was provided by all patients At the time of enrolment, each patient had to have a diagnosis of PsA for at least three...
... showcasing an “I not really care” attitude of negotiator This may happen in a situation when it may not worth the time and effort fora party to negotiate; or a party has very strong/weak alternative ... conjoint analysis to facilitate preference elicitation, alternative evaluation, as well as optional functions for Pareto-optimization in the post-negotiation settlement stage Negotiators can also ... our understanding of negotiation strategy and tactics For instance, 23 Chapter Literature Review on Negotiation traditional prescriptive theories of negotiation tell that in order to be effective,...
... growth rates of total output and total cost Increasing returns to scale indicate that growth rate of total output is greater than this of total cost Decreasing returns to scale indicate that growth ... decision variable of the vector i at the iteration τ The ith decision vector at the iteration τ The ith mutation vector at the iteration τ The ith trial vector at the iteration τ The objective vector ... inputs and outputs based on reactions to market prices DEA (Data Envelopment Analysis) is a mathematical programming based on nonparametric technique that is designed to compare and evaluate the...
... performance fee The takaful operator in this case acts as an agent for participants and manages the takaful/retakaful fund in return fora defined fee The paid-up capital is contributed as donation ... starts the work, the contract cannot be cancelled unilaterally Tawarruq Tawarruq is a sale of an asset to a purchaser with deferred payment The purchaser then sells the asset to the third party ... of the nth DMU The quantities of fixed bank parameters (bank capital and fixed assets) Profitability= net income / total assets Personal expenses = total amount of wages and salaries / total assets...
... “(organizations)…are gradually becoming aware that knowledge cannot be treated as an 19 organizational asset without the active and voluntary participation of the communities that are its true owners A shift ... management systems It is important to note that they are not only tools that can manage data, they need to support information and knowledge This involves linking data to context and meaning and linking ... Define the units of analysis • Calculate: Mathematically or statistically analyze the data • Correct: Errors are removed • Condense: Summarize the data These methods transform data into information...
... constraints would be constant when the user does not care about the attributes Each constraint depends on the type of attribute the object has A numeric attribute can have a range constraint and ... ground truths are used to train and evaluate Query Translator By annotating important web pages only, the system reduces the developer’s effort to train the Translator Learner Query Translator Learner ... challenges about scalability and adaptability The thesis studies a novel machine learning framework to solve the object search problem and evaluate this approach to a Vietnamese domain - real estate It...
... what Wiener and Doescher (1991)'term a structural solution, that is, a political act that mandates individual behavior For Taylor and Singleton (1993), the distinction between marketing and law ... education, marketing marketing resistant to behave resistant to behave law marketing, law unable to behave resistant to behave resistant to behave education, marketing education, marketing, law ... inefficient, in that it forces either a third party to accommodate a need that was not pursued in tile past or tile target to behave inefficiently for the benefit of the manager Another way to consider...
... of the focus point placement policy The statistics are taken with the correct (gold-standard) actions It is clear from Table that the policies result Note that (Yamada and Matsumoto, 2003) mention ... sentences that have a complete correct analysis We also measure that root accuracy (RA) and leaf accuracy (LA), as in (Yamada and Matsumoto, 2003) When evaluating the result, we exclude the punctuation ... parent and children for each word) Note that State changes when a prediction is made and that the features extracted for the action classifier also depend on State The search algorithm will perform...
... perspective) The values of R2 vary between and 1, with a value of indicating that the automatic evaluation explains perfectly the human evaluation variation, anda value of indicating that the automatic ... faithfulness/compactness ratio In this case, our evaluation framework predicts that the automatic evaluation metrics that explain most of the variation in the human evaluation must have a low α anda high N As ... evaluation framework predicts that the automatic evaluation metrics that explain most of the variation in the human evaluation must have a low α anda median N As seen in Table 5, our evaluation...
... reparandum is still available For each utterance in the input, the parser needs to find an interpretation that starts at the first word of the input and ends at the last word This interpretation ... interpretations of an utterance with a speech repair One interpretation includes all of the utterance up to the reparandum end but stops at that point; this is what the speaker started to say, and ... interpretation of what the user started to say In some cases, what the user started to say is a complete constituent: take 2The parser's lexicon has a list of 35 editing terms that activate the...
... of the representation language from the application program and systematically translating it into a natural language using syntactic/semantic rules which were primarily designed for translating ... abstraction with an appropriate term We suggest instead that the best way to get an NL system to generate text to satisfy the requirements of some application program is for it to offer suggestions ... describe a theme anda theme Admittedly this still presumes that the application program knows enough about the linguistic theory to know about themes and themes, but at least it does not need to know...
... amount of the surplus Total Capital that is attributable to the third party investors is calculated by multiplying the surplus Total Capital by the percentage of Total Capital that is held by third ... tax liabilities (DTLs) only if the DTAs and DTLs relate to taxes levied by the same taxation authority and offsetting is permitted by the relevant taxation authority Where these DTAs relate to ... aggregate CCR and CVA risk capital charges This paragraph deals with the aggregation of the default risk capital charge and the CVA risk capital charge for potential mark-to-market losses Note that...