sách thành viên nhóm 8 thực hiện
HUMAN PHYSIOLOGY ppsx
... from? The concept of homeostasis was first articulated by the French scientist Claude Bernard ( 181 3 187 8) in his studies of the maintenance of stability in the "milieu interior." He said, "All the ... .262 15 The Male Reproductive System 281 16 The Female Reproductive System .301 17 Pregnancy and Birth 326 18 Genetics and Inheritance 351 19 ... Nervous System 54 05 Senses 81 06 The Muscular System 107 07 Blood Physiology 122 08 The Cardiovascular System .137 09 The Immune...
- 432
- 2,733
- 1
báo cáo hóa học:" Social care and changes in occupational accidents and diseases - the situation in Eastern Europe in general and for skin diseases in particular" pptx
... (SLI) ▲ 6.9 (2004) ▲ Lithuania 295 ▼ 9.6 ▼ Poland 87 8 ▲ 4.6 ▲ Romania 75 ▼▼ ▼▼ Slovakia 6 78 ▲ ▲ Slovenia 4437 ▼ 3 .8 ▲ Albania n.s n.s Belarus 95 ▼▼ 5 .8 ▼ Bosnia-Herzegovina n.s n.s Croatia 1645 ▲ ... Fatal occupational injuries per 100,000 Bulgaria 187 (2005) ▼▼ 5 .8 (2005) ▼ Czech Rep 183 0 ▼▼ 3.4 ▼▼ Cyprus 745 ▼ ▲ Estonia 561 ▲ 4.3 ▲ Greece 10, 684 (total/2005) ▼ 772 (2003) 5.4 (2003) ▲ Hungary ... Full Invalidity: from 80 % Page of 15 (page number not for citation purposes) Journal of Occupational Medicine and Toxicology 2009, 4: 28 http://www.occup-med.com/content/4/1/ 28 Table 2: Comparison...
- 15
- 389
- 0
Incoterms 2010 changes summary
... Tower, 15 Tran Phu Str., Ngo Quyen Dist., Hai Phong City Tel: 84 31 3652 145/46/ 48 Ext: 110 Fax: 84 31 3652 147 Cellphone: 0 989 664 81 8 Email: hung.vu@tnnlogistics.com.vn / sales@tnnlogistics.com.vn ... 2010; thực thay đổi tương ứng (ví dụ đổi điều khoản DES hay DDU INCOTERMS 2000 thành DAP INCOTERMS 2010) mẫu hợp đồng chuẩn bạn hợp đồng mới; công bố thay đổi cho đối tác biết, cho nhân viên ... đồng chuẩn bạn hợp đồng mới; công bố thay đổi cho đối tác biết, cho nhân viên kinh doanh nhân viên thực hợp đồng bạn biết; bắt đầu sử dụng INCOTERMS 2010 chuẩn mực hợp đồng mua bán bạn Bộ qui...
- 7
- 752
- 2
Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"
... 123.3( 18. 3) 120.3(9.0) 120.9(11.4) 119.3(15.5) 130 .8( 10.2) 0.317 Baseline Ending HEART RATE 71.3(6.9) 75.0(9.1) 73 .8( 6.4) 74.6 (8. 3) 77.0(6.3) 75.5(10.0) 72.7(9 .8) 71 .8( 10.0) 76.9(6.4) 75.3(7 .8) 0.316 ... unshiu Marcovitch) J Agric.Food Chem 20 08; 56: 88 74 -88 78 Stohs SJ, Preuss HG The safety of bitter orange (Citrus aurantium) and p-synephrine HerbalGram 2011; 89 : 34-39 Inchiosa MAJr Evidence (mostly ... 76.9(6.4) 75.3(7 .8) 0.316 0 .89 1 Baseline 64.5(11.2) 72.3(5.1) 70.0(14.0) 71.6(13.3) 69.4(6.4) 0.5 18 Ending 62.7(9.4) 71.6(6.7) 65.7(9.0) 68. 6(9.5) 68. 0 (8. 4) 0.206 1ANOVA Placebo: V -8 juice only, T2: 50...
- 7
- 641
- 0
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... 62 :88 9 -89 9 77 Prynne CJ, Mishra GD, O'Connell MA, et al: Fruit and vegetable intakes and bone mineral status: a cross sectional study in age and sex cohorts Am J Clin Nutr 2006; 83 :1420-14 28 78 ... 2001;12:763-7 68 26 Meyer HE, Tverdal A, Selmer R Weight variability, weight change and the incidence of hip fracture: a prospective study of 39,000 middle-aged Norwegians Osteoporos Int 19 98; 8: 373-3 78 27 ... effectiveness program Ann Intern Med 20 08; 1 48: 956-961 36 Alexander GC, Stafford RS: Does comparative effectiveness have a comparative edge? JAMA 2009; 301:2 488 -2490 37 Kaats GR, Preuss HG, Leckie...
- 12
- 663
- 0
Báo cáo y học: "Changes of uterine blood flow after vaginal radical trachelectomy (VRT) in patients with early-stage uterine invasive cervical cancer"
... Apgar 588 g score 1(1min.)/1(5min.) pathology of placenta Ischemic change(-) CAM(+) prognosis NED 27 months age(years) and parity Patient 28 P0(0) SCC stage Ib1 34 weeks + day 186 2g 7(1min.) /8( 5min.) ... trachelectomy: a treatment to preserve the fertility of cervical carcinoma patients Cancer 2000; 88 : 187 7- 188 2 10 Jolly JA, Battista L, Wing DA Management of pregnancy after radical trachelectomy: case ... Gynecol Oncol 20 08; 111:S105-S110 12 Martin X.J.B, Golfier F, Romestaing P, Raudrant D First case of pregnancy after radical trachelectomy and pelvic irradiation Gynecol.Oncol 1999;74: 286 - 287 http://www.medsci.org...
- 7
- 425
- 0
An analysis of key changes under ucp 600 compared to ucp 500 and recommendations for better ucp 600 application.doc
... presented to Banks led to ICC’s authorization of the revision in November 1 989 of UCP Publication No 400 published in 1 983 International judicial decisions and technological innovations were considered ... confirmation, amendments, availability and nomination The next six articles from Article 14 to 18 and article 28 look at two difference aspects including the compliance of the documents and the definition ... definition of “Complying presentation” in article 2.2 .8 Changes in some other articles Discount of deferred payment undertaking under Article 7c, 8c and 12 Nomination of a bank includes authorizing...
- 89
- 965
- 2
Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"
... variable 28 (V 28) RIKEN cDNA 3110049J23 RIKEN cDNA 5730437N04 Similar to Ig lambda-1 chain C region RIKEN cDNA B230118H07 Z Ratio 16M-1M 13 .81 Z Ratio 24M-1M 12.67 9.02 7. 98 2.04 AF152371 6 .89 6 .85 ... 433053 681 70 Mm.333124 Mm.3 685 63 Mm.46654 J00 582 Mm.31263 1.76 4.61 5.20 1.66 -2.49 7.14 3.67 5 .88 6.52 -2.26 5.07 5.06 4.79 4.63 -2.62 22640 Mm.4 184 -3.09 -2.34 -2.72 33197 Mm.2222 28 -3.27 -3.26 ... ATGTCCAGGCCTCTGCTTTA GTCTT NM_0 188 53 Rplp1 3.90 3.49 3. 78 4.7 CACGGAGGATAAGAT ATGAGGCTCCCAATGTTGAC CAATGC NM_007475 Arbp 3. 38 3.79 3. 78 77* TCGTTGGAGTGACAT CGTCT NAP0 187 10-0 B-actin 2. 78 01 2.14 3.51 NC CTAAGGCCAACCGTG...
- 14
- 464
- 0
khảo sát tỷ lệ bệnh hen kèm theo ở bệnh nhân viêm mũi xoang mạn có biểu hiện dị ứng và skin prick test dương tính
... mẫu nghiên cứu Số lượng bệnh nhân Tỷ lệ Ngứa mũi 152 95% Hắt 1 58 98, 75% Sổ mũi 1 58 98, 75% Nghẹt mũi 145 90,63% Có triệu chứng 137 85 ,63% Có triệu chứng ngứa mũi + nhảy mũi triệu chứng nghẹt mũi ... trung bình - nặng Sau đó, so sánh tỷ lệ hen nhóm KẾT QUẢ Những đặc điểm dịch tễ học Bảng Đặc điểm mẫu giới Số lượng bệnh nhân Tỷ lệ % Nam 67 41 ,88 % Nữ 93 58, 12% Tổng cộng 160 100% Bảng Tỷ lệ triệu ... 33,33 Từng đợt, TB-nặng 17 41 58 29,31 Dai dẳng, nhẹ 11 27,27 Dai dẳng, TB-nặng 25 57 82 30,49 Tổng cộng 48 112 160 30 Nhận xét: Không có khác biệt có ý nghĩa tỷ lệ hen nhóm BN theo phân loại ARIA...
- 38
- 631
- 1
Tạo Theme Skin cho Blog Opera
... winrar ) Giải nén up file ảnh lên host bạn up vào phần Files Opera Đổi đường dẫn ảnh files user.css thành đường dẫn ảnh đến blog bạn Đăng nhập vào blog Opera bạn, vào mục My Account (ở phía blog ấy) ... tới có đợt share huge skin for teen and for girl , bạn ý theo dọi kịch tính Tới thời điểm ngày 08/ 06/2007 ShoutBox Phạm Lâm lười chưa sửa Trong thời gian tới bạn vào để có code css có phần ShoutBox...
- 2
- 494
- 0
Status and changes of mangrove forest in Mekong Delta: Case study in Tra Vinh, Vietnam
... (LAI) (Lorenzo et al., 1979; Bina et al., 1 980 ; Untawale et al., 1 982 ; Patterson and Rehder, 1 985 ; Blasco et al., 1 986 ; Ranganath et al., 1 989 ; Roy, 1 989 ; Chaudhury, 1990; Dutrieux et al., 1990; ... Reforestation Unchanged mangrove 2235 1434 5642 4996 87 7 2245 5619 86 3 22 58 14,2 08 5 784 7013 P.M Thu, J Populus / Estuarine, Coastal and Shelf Science 71 (2007) 98e109 105 Fig Map of mangrove forest changes ... M., Gauquelin, T., Denis, J., 19 98 A Remote Sensing based methodology for mangrove in Madagascar International Journal of Remote Sensing 19, 187 3e 188 6 Roy, P.S., 1 989 Mangrove vegetation stratification...
- 12
- 741
- 1
Seasonal Changes of Shallow Aquatic Ecosystems in a Bird Sanctuary Pond
... J and Bérubé J (1 980 ) Assessment of the importance of nutrient recycling by seabirds in the St Lawrence Estuary, Canadian Journal of Fisheries and Aquatic Sciences, 37, 583 - 588 Dobrowolski A K., ... Apache National Wildlife Refuge, New Mexico, Limnology and Oceanography, 44(3), 82 8 -83 6 Kurechi M and Otsu M (1 983 ) Estimate of the carrying capacity of the wintering geese in Japan (1) Energy ... phosphorus dynamics in a freshwater reservoir, Freshwater Biology, 50, 88 2 -89 0 Pettigrew T C., Hann J B and Goldsborough G L (19 98) Waterfowl feces as a source of nutrients to a prairie wetland: responses...
- 9
- 430
- 0
Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan
... Ave 5 .85 5.0 32 .8 28. 9 0.02 0. 38 Max 8. 47 13.2 85 .3 85 .2 0.25 2.23 Min 4.15 1 .8 6.5 4.5 N.D 0.01 S.D 1.10 1 .8 17 .8 16.6 0.04 0.51 Ave Max Min S.D Zn 0.36 8. 74 0.02 0.97 Sr 0.32 0.69 0. 08 0.15 ... 0.12 Fe 0.03 0.69 N.D 0. 08 DP* Na+ K+ Ca2+ 0.42 21.6 8. 2 54 2.97 40.1 21 .8 122 0.01 3.5 0.9 15 0.57 8. 7 5.9 25 Mg2+ 18. 3 44.2 16.6 9.3 Pb Cl- SO420.03 23.0 169 0.33 43.0 387 N.D 9.0 50 0.05 9.1 ... Ca2+ Al3+ 2. 08 3.25 1.24 6.19 0.61 (0.66) (0 .81 ) (0.60) (1.24) (0.32) CEC** degree of TP water-soluble P [meq/100g] saturation*** [ - ] [mg-P/100g] [mg-P/100g] 9.05 1.41 2 28 4. 28 * measured with...
- 10
- 717
- 0
Changes of temperature data for energy studies over time and their impact on energy consumption and CO2 emissions. The case of Athens and Thessaloniki – Greece
... 9. 58 9.90 11.72 15.75 20.63 25. 38 27.96 27.53 23 .83 18. 87 14.26 10.65 18. 00 1 983 -1992 6.13 6 .86 9 .83 14. 58 18. 86 23.31 25.93 25.53 21.92 16.16 10.91 6.60 15.55 Thessaloniki 1993-2002 6.34 7 .84 ... Base Temperature 18 16 14 12 10 18 16 14 12 10 18 16 14 12 10 18 16 14 12 10 18 16 14 12 10 18 16 14 12 10 18 16 14 12 10 18 16 14 12 10 1 983 – 1992 47 22 131 84 46 21 244 184 1 28 80 44 266 204 146 ... [Kdays] Heating av 1 983 - 2002 1000 80 0 600 400 200 Cooling av 1 983 - 2002 2002 2001 2000 1999 19 98 1997 1996 1995 1994 1993 1992 1991 1990 1 989 1 988 1 987 1 986 1 985 1 984 1 983 Year Figure Heating...
- 14
- 548
- 0
SKIN- BỒI DƯỠNG HỌC SINH GIỎI ĐỊA LÍ
... Năm 1990 19 98 2000 2003 2005 Đờng sắt 2341 49 78 6 285 83 85 88 38 Đờng 54640 123911 141139 172779 212263 Đờng sông 27071 380 34 43015 55254 62 984 Đờng biển 4359 11973 15553 27449 331 18 Nhận xét giải ... Năm 1990 19 98 2000 2003 2005 Đờng sắt 2341 49 78 6 285 83 85 88 38 Đờng 54640 123911 141139 172779 212263 Đờng sông 27071 380 34 43015 55254 62 984 Đờng biển 4359 11973 15553 27449 331 18 a Vẽ biểu ... thời kỳ 1 985 2000 ( Đơn vị : Triệu Rúp USD) Năm Tổng số Xúât Nhập 1 985 1990 1992 1995 2000 2002 2555,9 5156,4 5121,4 13604,3 30119,5 364 38, 8 6 98, 5 2404,0 2 580 ,7 54 48, 9 14 483 ,0 16705 ,8 185 7,4 2752,4...
- 11
- 1,030
- 16
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25