suppressive vaccination with dna encoding a variable region gene of the t cell receptor
Báo cáo y học: " High avidity autoreactive T cells with a low signalling capacity through the T-cell receptor: central to rheumatoid arthritis pathogenesis" pot
... predicted to impair positive and negative selection of autoreactive T cells [22,23] Within the context of SKG and RA T cells, it is interesting that carriage of the variant allele was also associated ... susceptibility of thymocytes to death and the capacity of the T- cell receptor (TCR) and downstream pathways to transmit an activation signal Moreover, the efficiency of self-antigen presentation depends ... propose that infection is intimately associated with the HLA susceptibility locus Shared epitope alleles are common in the Caucasian population but they are strongly associated with RA, along with the...
- 9
- 406
- 0
Báo cáo y học: "Effect of dexmedetomidine versus lorazepam on outcome in patients with sepsis: an a priori-designed analysis of the MENDS randomized controlled trial" doc
... incorporating DEX have a greater impact on these important outcomes in patients with sepsis than in patients without sepsis These findings suggest that choice of sedative is vitally important in the ... potential benefits of sedation with drugs targeting the α2 adrenoceptor rather than the GABAA receptor Abbreviations APACHE: Acute Physiology and Chronic Health Evaluation; CAM-ICU: Confusion Assessment ... residuals [50] Efficacy of sedation Among the septic patients, those sedated with DEX achieved sedation within one point of their ordered RASS target more often than those sedated with LZ (accurately...
- 12
- 421
- 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... CCCTACTCCAG-3¢ and 3¢ primer, 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC ... region encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with ... GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer and the second 3¢ primer The final amplified DNA was ligated into pET26b and...
- 9
- 485
- 0
Báo cáo khoa học: Utp25p, a nucleolar Saccharomyces cerevisiae protein, interacts with U3 snoRNP subunits and affects processing of the 35S pre-rRNA docx
... 5¢-GCTCTCATGCTCTTGCCAAAAC-3¢ 5¢-CGTATCGCATTTCGCTGCGTTC-3¢ 5¢-CTCACTACCAAACAGAATGTTTGAGAAGG-3¢ 5¢-GTTCGCCTAGACGCTCTCTTC-3¢ 5¢-GCCGCTTCACTCGCCGTTACTAAGGC-3¢ 5¢-TGTTATCCTCTGGGCCCCG-3¢ 5¢-ATGGGGCTCATCAACCAAGTTGG-3¢ ... UTP25: 5¢-CCCGGGTGGATCCATGAGTGACAGTTCT GTGAG-3¢ and 5¢-CTCGAGTTATTTAAATTCATAAAT TTCCTTTTGTGC-3¢ For the two-hybrid assays, the PCR product was digested with SmaI and XhoI and cloned into pBTM116 ... pre-rRNA maturation In order to determine the portion of Sas10p that is responsible for the interaction with Utp25p, two Sas10p truncated mutants were fused to Gal4-AD and the interaction with Utp25p...
- 15
- 328
- 0
Báo cáo khoa học: Glycolipids with nonreducing end a-mannosyl residues that have the potential to activate invariant Va19 NKT cells pptx
... activate Va19 Tg+ cells without them being loaded with any antigens (Fig 5), although the activation was less efficient than the stimulation with the MR1 transfectants previously loaded with a- mannosyl ... kDa band with anti-MR1 serum staining, corresponding to the band with anti-FLAG staining (data not shown) Stimulation of Va19 Tg+ cells with MR1 transfectants MR1 transfectants or their parental ... that activate NKT cells A B Fig Stimulation of invariant Va19 TCR+ cells with mutated MR1 transfectants (A) Stimulation of Va19 Tg cells with MR1 transfectants deficient in b-GlcCer synthase [19]...
- 12
- 370
- 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
... cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA Amplification was performed using the Advantage Polymerase (Clontech) with initial denaturation ... However, cell extracts from the double transfectants showed a high N-acetylgalactosaminyltransferase activity and a weak galactosyltransferase activity These results indicate that the new rat enzyme ... members, the ABO gene itself, the a3 galactosyltransferase (pseudo B) gene [17], the aN-acetylgalactosaminyltransferase or Forssman synthetase gene [18] and the a- galactosyltransferase iGb3 synthetase...
- 8
- 499
- 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... sequence of the RT-PCR product generated with Kin2 terminates appears that the TPa, but not the TPb, mRNA contains E1 and E1b sequences To further characterize the 5¢ UTR of the TP mRNA transcripts, ... 2C,D) and these data correlate with findings in the trophoblast TM-1 cell line (data not shown) Thereafter, a 5¢ RACE approach was adopted to identify the TI sites of the TP mRNA transcripts in ... )8261 region upstream of the +1 (ATG translational start site) within the TP gene While, in the current study, we have indeed established that PMA up-regulates P3 transcriptional activity, further...
- 16
- 321
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
... constant coil placement throughout the experiment During stimulation, the center of the coil was placed tangentially to the scalp with the handle pointing posterior and laterally rotated at a 45° angle ... direction of the TMS-induced twitch to that of the practice direction It remains to be investigated how the relationship between agonist and antagonist muscle activation might lead to this direction ... acquisition and learning are associated with an increase in target muscle cortical excitability and a modulation of intracortical inhibition, but the relationship of cortical excitability changes...
- 8
- 432
- 0
báo cáo hóa học:" Acromioclavicular joint dislocation: a comparative biomechanical study of the palmaris-longus tendon graft reconstruction with other augmentative methods in cadaveric models" docx
... involves a direct trauma to the superior aspect of the acromion and includes inferior and anterior translation of the acromion in relation to the distal aspect of the clavicle Operative treatment has ... concave aspect of the acromion The medial concave aspect of the acromion, articulating with the lateral end of the clavicle, most closely approximated the arc of a semi-ellipse The centroid of acromion, ... http://www.josr-online.com/content/2/1/22 that of the combined native ligaments The discrepancy in results arose because Grutter et al compared the tensile strength of the reconstruction with that of the native ACJ capsule...
- 10
- 738
- 0
Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot
... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAACCTC EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA ... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from pMBP-TK ... pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC AGGAAAAAAATTTAAATGAGTTAGCCTCCCCCATC AGGAAAAAATTCGAATCAGTTAGCCTCCCCCATC plasmid was then used to replace the E3 region by the CMVp and TCS, in pTG3622,...
- 4
- 451
- 0
Báo cáo lâm nghiệp: " A flow cytometric evaluation of the nuclear DNA content and GC percent in genomes of European oak species" pptx
... introduced variability, as evidenced by our tight standard deviations Unfortunately, there are no available microdensitometry or flow cytometry data on the DNA content in other Fagaceae gen- (Castanea, ... spp and found that buffers with a high chelating capacity (Marie’s buffer and that of Galbraith et al, 1983) ensured greater stability and uniformity It is noteworthy that our cytometric data for ... extended to estimate the ploidy level of Quercus plants on the basis of genome size relative to a standard plant of known ploidy MATERIALS AND METHODS The plant material was leaves of in vitro cloned...
- 3
- 243
- 0
Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf
... one of these patients, the eradication treatment was started together with antiretroviral therapy (stavudine, lamivudine and indinavir) Both patients obtained, almost initially, a complete remission ... chemotherapy and a surgical treatment was then planned Waiting this treatment, the patient underwent an HP eradication therapy He received a triple therapy with omeprazole (20 mg twice a day), amoxicillin ... large Bcell lymphoma treated with anti HP treatment and all cases of primary gastric large B -cell lymphoma treated in prospective studies with anti HP-therapy According to the WHO classification,...
- 7
- 373
- 0
báo cáo khoa học: "Partial tetraplegic syndrome as a complication of a mobilizing/manipulating procedure of the cervical spine in a man with Forestier’s disease: a case report" pot
... of the manuscript and gave their approval for the final manuscript Page of Competing interests The authors declare that there are no competing interests that could inappropriately influence the ... our institution The scan shows a persistent luxated position of the fracture at level C6/7 after dorsal stabilization at the outside hospital seen by Schmitz et al and Ea et al., respectively ... events [15] Then again, Kerry et al state in their critical literature review in 2008 addressing the association between cervical spine manual therapy and cervical artery dysfunction, that ‘it...
- 4
- 319
- 0
Báo cáo y học: "Effect of the dual endothelin receptor antagonist bosentan on untreatable skin ulcers in a patient with diabetes: a case report" ppsx
... initiation of bosentan therapy and two weeks’ treatment at a maintenance dose, with marked granulation tissue apparent on the heel (F) Complete healing of the ulcer was observed after a total of 21 ... delineated with a necrotic appearance, without granulation tissue, and covered by purulent exudates A general examination indicated that the patient had congestive heart failure probably due to ischemic ... throughout the patient’s ulcer-specific treatment Treatment of the ulcer itself was initiated by the patient’s general practitioner with oral ciprofloxacin 500 mg every 12 hours for two months As a...
- 4
- 337
- 0
báo cáo khoa học: "A solid pseudopapillary tumor of the pancreas treated with laparoscopic distal pancreatectomy and splenectomy: a case report and review of the literature" ppt
... fails to provide a lymphadenectomy comparable to that of open distal pancreatectomy, a fact that may limit the applicability of laparoscopic surgery to the treatment of pancreatic adenocarcinoma The ... neoplasms of the pancreatic body and tail, providing a morbidity rate comparable to that of the open procedure and a substantially shorter length of stay However, laparoscopic distal pancreatectomy fails ... underwent distal pancreatectomy for indications other than chronic pancreatitis and found that distal pancreatectomy with splenectomy had a lower morbidity rate, and pancreasrelated complications...
- 4
- 236
- 0
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt
... incubated at 60°C for 30 min, then a total of 16 at 98°C After centrifugation at 10,000 × g at 4°C, the supernatant was transferred to a clean tube and stored at -20°C Tubes were placed in a thermal ... staining pattern revealed a characteristic staining pattern with the terminal web and the lateral junctions of intestinal epithelial cells (Figure 1A) Discussion Based on gene expression data, ... in the terminal web of the epithelial cell and in the lateral junctions of the cells The localization of CSF1R in actin-rich areas of the cell is not surprising in view of data from in vitro studies...
- 8
- 294
- 0
báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps
... future Abbreviations ACT, adoptive cell transfer Competing interests The authors declare that they have no competing interests Authors’ contributions Both authors wrote the article Author information ... which marks a new era in adoptive T- cell therapy because of the increase in the amount and survival of infused T cells found with this system Their system for the control of mammalian T- cell proliferation ... laboratory environments Yet applying these RNA-based regulatory systems in clinical practice may still require more time In addition, there are many other factors that limit the use of adoptive...
- 3
- 239
- 0
Báo cáo y học: " Successful long-term monotherapy with rituximab in a patient with chronic lymphocytic leukemia of the B-cell-lineage: a case report" pdf
... rituximab was tapered, with two administrations of 375 mg/m2 in January and in April 2006 Since WBCs started to rise again months after the last administration, rituximab maintenance therapy was reassumed ... response-adjusted rituximab maintenance therapy in 12 patients with pretreated B-CLL [6] It is important to underline that the response to rituximab became apparent when the dosage of the drug was increased ... response to standard chemotherapy and with successful treatment with rituximab monotherapy Because, so far, there is no clinical evidence favoring early chemotherapeutic treatment of B-CLL, therapy...
- 5
- 257
- 0
Báo cáo y học: "Characterizing the expression of the human olfactory receptor gene family using a novel DNA microarray" pps
... reciprocal best hits were obtained using two-way blastp [44] searches of Additional data files The following additional data are available with the online version of this paper Additional data file ... given the statistical cutoff and the number of genes on the array (see Table for results using alternative statistical cutoffs) These results were validated by performing RT-PCR on ten randomly ... data file is a figure of the analysis of co-similarity of either the untranslated or the coding region probe-sets Additional data file provides supplementary materials and methods Supplementary...
- 10
- 261
- 0
Báo cáo y học: "Sequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the requirements for tissue rejection" pps
... Additional data files The following additional data are available with the online version of this paper Additional data file provides a list of genes previously shown to be associated with the stimulation ... was designed to evaluate the early transcriptional events induced by topical imiquimod administration RNA isolation and amplification and cDNA arrays Total RNA was isolated with RNeasy minikits ... cytokines [27] Another NK cell- related gene is that encoding Cathepsin w, a cysteine proteinase associated with the membrane and the endoplasmic reticulum of NK and T cells and regulation of their...
- 15
- 339
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25