0

suppose a ¼ ½ a1 a2 a and b ¼ ½ b1 b2 bs are two

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học

... 45 by up-regulating the synthesis and < /b> release of endogenous basic fibroblast growth factor J Biol Chem 268, 17397–17403 Lianos, E .A < /b> & Bresnahan, B .A < /b> (1999) Effect of thromboxane A2 /b> inhibition and < /b> ... antagonism on prostaglandin and < /b> leukotriene synthesis in glomerular immune injury J Laboratory Clin Med 134, 478–482 Ushikubi, F., Aiba, Y., Nakamura, K., Namba, T., Hirata, M., Mazda, O., Katsura, ... potential TP mRNA transcripts (A)< /b> The human TP gene contains three exons E1, E2 and < /b> E3 separated by two introns I1 and < /b> I2 An additional exon, E 1b, is located within I1 and < /b> there are two putative...
  • 16
  • 321
  • 0
600 sentences of certificate A and B

600 sentences of certificate A and B

Cao đẳng - Đại học

... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a < /b> the b a < /b> c an d no article > b 50 That is eraser a < /b> the b a < /b> c an d no article ... the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class a < /b> the b a < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over ... being started by hand But now they are started by electricity a < /b> used b being c But now d are > b 33 This house is often broken off and < /b> a < /b> lot of things are taken away a < /b> is b broken c off d away ...
  • 280
  • 884
  • 3
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Báo cáo khoa học

... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and < /b> annealed to a < /b> prepared ... incubation FEBS Journal 276 (2009) 24022415 ê 2009 The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a-< /b> and < /b> b- chitin The degradation rates of a-< /b> and < /b> b- chitin were assayed ... amyloliquefaciens, in that both proteins bind well to both a-< /b> and < /b> b- chitin As noted above, ChbB is the closest homologue of LlCBP3 3A < /b> and < /b> the two proteins share sequence characteristics that separate...
  • 14
  • 683
  • 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học

... form a < /b> distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available ... Zn4aMT and < /b> Zn3bMT with those observed for Cd7MT [20] Presence (+) or absence (–) of NOEs is indicated b- Domain Proton Asn (a)< /b> Asn (a)< /b> Asn (b) Cys (a)< /b> Cys (b) Asn 23 (b) a-< /b> Domain Lys (NH) Lys (a)< /b> ... The spectral resonances were assigned to all the protons present in the two domains and < /b> are listed in supplementary Tables S1 and < /b> S2 This result indicates that the two domains are stable and < /b> independent...
  • 14
  • 485
  • 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học

... (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... range are fitted with a < /b> biexponential function: 0 DAnorm ¼ < /b> aa Á expðÀka Á ½O2 Š Á tÞ þ ab ÁexpðÀkb Á ½O2 ŠÁtÞ ð2Þ where DAnorm is a < /b> normalized change in optical density of the sample and < /b> aa, ab, ... Here k a < /b> and < /b> k b are, respectively, the rate constants of BR for the a < /b> and < /b> b subunits within triliganded HbA Time courses for O2 rebinding are shown in Figs and < /b> The transient absorption decays were...
  • 11
  • 577
  • 0
The a and b adapters are used as priming sites for both amplification

The a and b adapters are used as priming sites for both amplification

Tin học

... The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are ... are broken, and < /b> the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> ... the wells not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only...
  • 19
  • 390
  • 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

Báo cáo khoa học

... flax leaves Galactolipids were separated and < /b> purified as described in Materials and < /b> methods EDE content was measured by UV absorbance of MGDG and < /b> DGDG fractions at 267 nm Average values and < /b> standard ... diglyceride, from Arabidopsis thaliana J Biol Chem 276, 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A < /b> and < /b> B, two new oxylipins from Arabidopsis thaliana Tetrahedron ... galactolipid molecular species from flax leaves Total galactolipids were extracted from flax leaves, separated and < /b> purified as described in Materials and < /b> methods UV chromatograms (267 nm) of galactolipids...
  • 10
  • 387
  • 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học

... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed ... a < /b> kinase and < /b> as a < /b> substrate depends on the molecular chaperone Hsp90 Proc Natl Acad Sci USA 96, 109–114 26 Citri A,< /b> Harari D, Shochat G, Ramakrishnan P, Gan J, Eisenstein M, Kimchi A,< /b> Wallach...
  • 11
  • 427
  • 0
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Báo cáo khoa học

... water for each Partial acetylation of serines and < /b> threonines was avoided by adding 12 lL of a < /b> solution containing 0.5 mm hydroxylamine and < /b> 100 mm NaOH to the reaction chamber and < /b> incubating at ... [28,29] Although a < /b> general stromal processing peptidase (SPP) has been characterized, and < /b> a < /b> preferred consensus sequence for cleavage between a < /b> basic amino acid (arginine or lysine) and < /b> a < /b> C-terminal ... Germany) Acetic anhydride, ammonium formate and < /b> 2,4,6-trinitrobenzenesulfonic acid (TNBS) were obtained from Fluka (Buchs, Switzerland), CoomassieÒ brilliant blue R250 was obtained from Serva (Heidelberg,...
  • 8
  • 362
  • 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học

... phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and < /b> the thymus A < /b> weaker signal was obtained from the pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland, ... sequences available in the NCBI database The programs used are all available from http://www.infobiogen.fr Chromosome localization The Abo gene was first assigned to a < /b> rat chromosome using a < /b> panel...
  • 8
  • 499
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Hóa học - Dầu khí

... Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726,713 ... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... pAD4000 For influenza A < /b> strains, the restriction sites were BsmBI (PB1, PA, NP, M, and < /b> NS) or AarI (PB2, HA and < /b> NA) For influenza B strains, the restriction sites were BsmBI (PB1, PB2, PA, HA,...
  • 12
  • 567
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Hóa học - Dầu khí

... Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726,713 ... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... pAD4000 For influenza A < /b> strains, the restriction sites were BsmBI (PB1, PA, NP, M, and < /b> NS) or AarI (PB2, HA and < /b> NA) For influenza B strains, the restriction sites were BsmBI (PB1, PB2, PA, HA,...
  • 12
  • 627
  • 0
2000 Test exam with A and B docx

2000 Test exam with A and B docx

Chứng chỉ A, B, C

... are tall a < /b> the b a < /b> c an d no article > d 54 Hoa is good pupil a < /b> the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class ... Where are Kate and < /b> Jane? - They English exercises in the classroom a < /b> are doing b is doing c are going d are going to > a < /b> 84 Tom and < /b> Mary are pupils but Ann a < /b> isn't b are c is d aren't > a < /b> 85 ... being started by hand But now they are started by electricity a < /b> used b being c But now d are > b 33 This house is often broken off and < /b> a < /b> lot of things are taken away a < /b> is b broken c off d away ...
  • 281
  • 349
  • 0
Báo cáo toán học:

Báo cáo toán học: "Parking functions of types A and B" ppsx

Báo cáo khoa học

... from some factorization (a1 /b> b1 ) (an bn ), then bn = an + as we just saw But (a1 /b> , , an−1 ) is a < /b> non-decreasing parking function of length n − Since a1 /b> , , an−1 ≤ an , relabeling an + 2, ... + as an + 1, , n, we see by induction hypothesis that there is a < /b> unique factorization (1 an an + n + 1) = (a1 /b> b1 ) (a2 /b> b2 ) (an−1 bn−1 ) therefore (1 n + 1) = (a1 /b> b1 ) (an an ... was absent in the type A < /b> case Let (a1 /b> , , an ) be a < /b> type B parking function Consider all the increasing rearrangements of (ck (a1 /b> ), , ck (an )) for k = 0, , n−1, then either these are...
  • 5
  • 367
  • 0
Báo cáo y học:

Báo cáo y học: " Hemoglobin a and b are ubiquitous in the human lung, decline in idiopathic pulmonary fibrosis but not in COPD" potx

Báo cáo khoa học

... exchange are disturbed Page 11 of 13 Additional material Additional file 1: Table S1 Detailed data of the morphometrical analysis of Hba and < /b> Hbb positive area (sum of the bronchial/alveolar epithelium ... Hba and < /b> Hbb positive area in bronchiolar/alveolar epithelium only was evaluated separately by excluding blood vessels, macrophages and < /b> interstitium (Epi) (D) Morphometrical analyses were evaluated ... and < /b> Hbb positive areas in bronchiolar/alveolar epithelium were evaluated by excluding blood vessels, macrophages and < /b> interstitium (Epi) (Figure 3D) Next, the positive area of Hba and < /b> Hbb was calculated...
  • 13
  • 349
  • 0
Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues

Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues

Hóa học

... plants, also known as Roxburghia They are found in South Asia, Malaysia and < /b> North Australia and < /b> are classified as subshrubs, or twining herbs, with thick and < /b> tuberous roots.5 This family can be divided ... medicinal applications Stemona and < /b> Croomia plants are used in both Japanese and < /b> Chinese folk medicine to treat an array of medical conditions The roots are boiled in water and < /b> the extracts consumed ... stay grounded and < /b> been a < /b> source of unwavering support over the years In particular, I want to thank my cousins Alanna and < /b> Camilla Mingay I think that I found the best travel companions ever and...
  • 289
  • 518
  • 0
A STUDY IN THE SELECTIVE POLYMORPHISM OF a  AND b GLYCINE IN PURE AND MIXED SOLVENT

A STUDY IN THE SELECTIVE POLYMORPHISM OF a AND b GLYCINE IN PURE AND MIXED SOLVENT

Cao đẳng - Đại học

... microscopy and < /b> x-rays (Fig 1.1) As a < /b> result, detailed rule-of-the-thumb knowledge and < /b> heuristics are available on the relationship between crystal growth and < /b> parameters such as temperature, supersaturation ... Morphologically Important BFDH Bravais-Friedel-Donnay-Harker rule BCF Burton-Cabrera-Frank theory PBC Periodic Bond Chain analysis ISA Interface Structure Analysis SCF Self-Consistent Field SAM Self-Assembled ... problem becomes computationally intractable We will show in a < /b> later part of the thesis, however, that it is possible to obtain reasonable solutions by making suitable approximations In particular,...
  • 170
  • 358
  • 0
Electrical, dielectric and magnetocaloric properties of selected a  and b site substituted manganites

Electrical, dielectric and magnetocaloric properties of selected a and b site substituted manganites

Thạc sĩ - Cao học

... Mr Prasanta Sahani, Mr Sashi Bhusan Rout, Mr Satyananda Kar, Mr Satyananda Barik, Mr Rajeeb kumar Jena, Mr Narahari Mahanta, Mr Bijay Kumar Das, Mr Satyanarayan Bhuyan, Mr Manish Singh and < /b> other ... in-law (Mrs Golap Manjari Behera), Brothers (Dr Subrat Kumar Barik and < /b> Mr Ratikanta Barik), Sisters (Mrs Saroj Bala Barik, Mrs i ACKNOWLEDGEMENTS Bandana Mahakud and < /b> Mrs Sujata Biswal), Brother-in-laws ... Brother-in-laws (Mr Dibakar Barik, Mr Manoranjan Mahakud, Dr Ramesh Biswal and < /b> Mr Kharabela Behera), sister in laws (Mrs Tanaya Barik and < /b> Mrs Rebati Barik) and < /b> nephews (Sonu, Sanjib, Guddu, Tutu, Prachi,...
  • 242
  • 417
  • 0
Palladium (II) catalyzed 5 endo epoxynitrile cyclizations   total syntheses of enokipodins a and b

Palladium (II) catalyzed 5 endo epoxynitrile cyclizations total syntheses of enokipodins a and b

Kỹ năng đọc tiếng Anh

... of DIPEA or absence of base afforded no cyclization products (Table 1, entries 13 and < /b> 14) This way, it was established that both base nature and < /b> metallic counter-ion are essential to achieve good ... Nuria Esterau, (a)< /b> Ishikawa, N K.; Yamaji, K.; Taharab, S.; Fukushi, Y.; Takahashi, K Phytochemistry 2000, 54, 777; (b) Ishikawa, N K.; Fukushi, Y.; Yamaji, K.; Tahara, S.; Takahashi, K J Nat Prod ... acquiring spectral data Supplementary data Scheme Preparation of precursor Supplementary data (experimental procedures and < /b> spectral data for compounds 1–2, 7, 8a< /b> b, 13) associated with this article...
  • 5
  • 485
  • 0

Xem thêm