supports families and communities in helping children maintain a healthy weight the program focuses on improving food choices increasing physical activity and reducing screen time spanish materials also available here http www nhlbi
Tài liệu Families and Households in Post-apartheid South Africa docx
... public One indication of this increasing concern about families and their social and economic circumstances is the rapid rate at which social and economic data on families and the households they occupy ... transitions on both the familial and non-familial levels in areas such as entering and leaving school, joining or quitting the labour force, leaving the parental home, migration, marriage, and ... networks are responsible for the increasing availability of quantitative data sets And, besides the increasing availability of quantitative data sets, some family scholars are making continuing efforts...
- 198
- 433
- 0
STRENGTHENING FAMILIES AND COMMUNITIES 2011 RESOURCE GUIDE doc
... important topics Also available on the site are an Evaluation Toolkit, archived teleconferences, a link to the FRIENDS Online Training Center, and downloadable FRIENDS factsheets, learning tools, and ... participate, that participants can access training stipend dollars, and that quality consultants and program mentors can provide support on implementation Initiatives in Missouri and Arkansas ... providing research, data, and analysis to the people and institutions whose decisions and actions affect children, including policymakers, program providers, foundations, and the media Visit the link...
- 94
- 206
- 0
Families and Households in Post-apartheid South Africa pot
... public One indication of this increasing concern about families and their social and economic circumstances is the rapid rate at which social and economic data on families and the households they occupy ... transitions on both the familial and non-familial levels in areas such as entering and leaving school, joining or quitting the labour force, leaving the parental home, migration, marriage, and ... networks are responsible for the increasing availability of quantitative data sets And, besides the increasing availability of quantitative data sets, some family scholars are making continuing efforts...
- 198
- 281
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc ... TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 Fig Sequence of recombinant plasmid DNA containing TI gene fragment...
- 9
- 497
- 0
Tài liệu Helping Children When a Family Member Has Cancer ppt
... please use the online order form on our website, www. cancercare.org CancerCare helps individuals and families better cope with and manage the emotional and practical challenges arising from cancer ... of the family are aware of the situation and have a chance to support each other Set the tone. As important as what you say is how you say it Try to use a calm and reassuring voice It’s okay ... of charge to anyone facing a cancer diagnosis If you have found this resource helpful and wish to donate, please so online at www. cancercare.org/donate You may also send a check payable to CancerCare;...
- 24
- 292
- 0
Tài liệu Preventing Fraud and Corruption in World Bank Projects: A Guide for Staff ppt
... and Central Asia, and East Asia and the Pacific Before joining the Bank, Mr Pino was an audit partner with a major international auditing firm in Chile, his home country, and taught business finance ... laws against fraud and corruption (Exhibits 3a and 3b) Standard Bidding Documents All Standard Bidding Documents (SBDs) and Standard Contracts contain clauses and provisions aimed at preventing ... each year audited in accordance with standards on auditing that are acceptable to the Bank An audit of such financial statements includes (a) an assessment of the adequacy of accounting and internal...
- 61
- 410
- 0
Visual art and education in an era of designer capitalism - deconstructing the oral eye
... especially in the arts, has by and large also abandoned the ethico-political concerns of agency and celebrated the body instead, forwarding spiritualism, naturalism, and emotionality as various forms ... the sex act itself in all its possible ‘perverse’ manifestations In Canada, a married gay couple can now adopt and raise their child in a loving environment and yet there also is also the practice ... take, inviting designers who are aware of their complicity in shaping the ecological environment and the political and influential role that the American National Association of Schools of Art and...
- 269
- 3,490
- 0
báo cáo hóa học:" Static platelet adhesion, flow cytometry and serum TXB2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary artery disease: a randomised cross-over study" potx
... and read and approved the final version of the manuscript Additional material Additional file All variables measured in the study A table showing all the variables that were measured in the study ... agonist addition and addition with the same agonist in the same concentration combined with a second agonist The combined addition was excluded unless it resulted in significantly increased adhesion ... adhesion to collagen in the presence of Mg2+ showed that both adrenaline and LPA induced a weak albeit significant decrease in platelet adhesion Since both LPA and adrenaline are platelet agonists,...
- 14
- 521
- 0
báo cáo hóa học:" Quality of life and pain in premenopausal women with major depressive disorder: The POWER Study" pdf
... the Pain and Palliative Care Service (PPCS) as part of the study protocol This evaluation was based purely upon practical considerations (evaluator availability and time constraints) rather than ... multifactorial nature of pain, severity of depression accounted only in part for pain intensity To further complicate matters, aggravating factors of pain such as fatigue and insomnia are also part ... quantitative and qualitative differences between groups in the Hassles Scale (Figure 1) and only Table 3: Pain location and intensity Location of pain head/neck no pain legs back arms generalized...
- 8
- 334
- 0
Báo cáo khoa học: "Gamma-ray irradiation stimulates the expression of caveolin-1 and GFAP in rat spinal cord: a study of immunoblot and immunohistochemistry" pot
... derapmoc erew nitca-ateb/1-niloevac fo soitar ehT )ASU ,daR-oiB( erawtfos tsylanA raluceloM gnisu dezylana dna )ASU ,daR-oiB ;007-SG( retemotisned resal gninnacs a htiw derusaem saw sisylana tolb ... star elam dlo -keew-xis ot -eviF ytilicaf lamina ruo ni derb dna )aeroK( kniloiB naheaD morf desahcrup erew star yelwaD-eugarpS slaminA sdohteM dna slairetaM la te nhA gnujeeM 013 .noitaidarri ... ytivitcaeronummi PAFG ni esaercni tnacifingis a swohs hparg rab ehT :B )IP dna ,4 ,1 fo syad ta( sdroc lanips detaidarri dna lamron ni noisserpxe )lenap rewol( nitca-β dna )lenap reppu( PAFG fo shpargorcimotohp...
- 6
- 374
- 0
Báo cáo y học: "How to integrate individual patient values and preferences in clinical practice guidelines? A research protocol" pps
... of the interview The package contains a one-page summary of the decision at stake, including a fact sheet describing benefits and risks for each option, as well as a copy of the current national ... text read aloud by the interviewer), asking for informed consent, explaining the anonymous character of data analysis, and permission for audio-taping the interview Open question on the interviewee’s ... the study are clear, and stimulates the participant to express his or her opinion by explaining that there are no good or wrong answers and that each opinion or idea will be included in the analysis...
- 9
- 429
- 0
Báo cáo khoa hoc:" Gliomatosis cerebri presenting as rapidly progressive dementia and parkinsonism in an elderly woman: a case report" ppt
... tumor-related infiltration involving both temporal lobes (Short strating arrow), inversion recovery MRI image demonAxial fluid-attenuatedand the substantia nigra (Long arrow) Axial fluid-attenuated inversion ... (perseveration, judgment trouble, confabulation, anosognosia and apathy) and memory impairment (short and medium recall) There were also deficits on tests of visuospatial ability Conversely, naming was ... Journal of Medical Case Reports 2008, 2:53 by diet The physical examination at the time of admission revealed an akineto-rigid bilateral, symmetrical parkinsonism Her gait demonstrated marked...
- 4
- 262
- 0
Báo cáo y học: "Stimulation dependent induction of fear and depression in deep brain stimulation: a case report" docx
... Hoque T, Halliday W, Lozano AM, Saint-Cyr JA: Determining the position and size of the subthalamic nucleus based on magnetic resonance imaging results in patients with advanced Parkinson disease J ... documentation during reprogramming IU performed all pre- and postoperative neuropsychological examinations and tests and interpreted these MS and AS finalized the manuscript References Benabid AL, ... systolic], tachycardia [> 150/min.], tachypnoea and severe sweating, which was already at a current of 1.5 mA After terminating the stimulation, the fear completely vanished in a few seconds The phenomenon...
- 4
- 335
- 0
báo cáo khoa học: " How to integrate individual patient values and preferences in clinical practice guidelines? A research protocol" pptx
... of the interview The package contains a one-page summary of the decision at stake, including a fact sheet describing benefits and risks for each option, as well as a copy of the current national ... text read aloud by the interviewer), asking for informed consent, explaining the anonymous character of data analysis, and permission for audio-taping the interview Open question on the interviewee’s ... the study are clear, and stimulates the participant to express his or her opinion by explaining that there are no good or wrong answers and that each opinion or idea will be included in the analysis...
- 9
- 292
- 0
Báo cáo y học: " Relationships among neurocognition, symptoms and functioning in patients with schizophrenia: a path-analytic approach for associations at baseline and following 24 weeks of antipsychotic drug therapy" ppt
... coordinated the development of the final draft All authors including IAL, WD, SKW, JGC, BS and RSEK participated in the analysis and interpretation of the data, and in drafting and/ or revising the ... empathy, and capacity for engagement and interaction The final subdomain used was the Interpersonal Relations [QLS Interpersonal], which measures the qualitative aspects of interpersonal relationships ... functional Figure domains3 Path diagram for relationships among cognition, symptoms, and occupational functioning at baseline for the functional domains: 1) QLS Instrumental, 2) QLS Intrapsychic, and...
- 12
- 274
- 0
báo cáo khoa học: " Opiate users'''' knowledge about overdose prevention and naloxone in New York City: a focus group study" doc
... counteract withdrawal by using again highlights a common misconception In truth, because naloxone only lasts 30 to 90 minutes after administration, any additional opiate consumption increases the ... increase participation in the program, reshape perceptions about naloxone among opiate users, and encourage naloxone comfort among those who carry it as a result of the program Naloxone has been ... response, specifically naloxone; 2) understanding and perceptions of naloxone; 3) potential comfort level with naloxone administration; and 4) feedback about increasing the visibility and desirability...
- 7
- 256
- 0
Báo cáo y học: " Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women" potx
... to examine the amount, patterns and evolutionary significance of inter- and intragenic recombination both within single infection strains and between strains in multiple-infected individuals Most ... detected as a continuation of the multipleinfection because the section of the genes that came from the secondary strain was so small that the recombinant clustered with the primary infecting strain ... questionnaire and received a physical examination [23] Informed consent was obtained from all study participants at the individual WIHS sites and human experimentation guidelines of the individual...
- 12
- 331
- 0
Báo cáo y học: "Sexual risk behavior and pregnancy in detained adolescent females: a study in Dutch detention centers" pps
... majority of the available places, and because females are placed in a JJI on a random basis (when a place is available) , this study sample was considered representative for the population of detained ... obtained from the institution file by means of a checklist Information on contraception, medication, and method of pregnancy termination were gathered from the medical file Information on sexually-transmitted ... sexually-transmitted diseases (STDs) (lifetime) was gathered from the medical file as an indication of sexual risk behavior Social and Health Assessment (SAHA) The Social and Health Assessment (SAHA)...
- 7
- 257
- 0
Báo cáo y học: "Influence of genetic variability at the surfactant proteins A and D in community-acquired pneumonia: a prospective, observational, genetic study" pot
... microbial clearance and inflammation [8,35] Exogenous surfactant preparation containing the hydrophobic SP-B and -C are nowadays widely used for replacement therapies in infantile RDS In addition, intratracheal ... Haplotypes 6A1 2, 1A1 0 and 6A to 1A are overrepresented among patients who died at 28 or 90 days By contrast, 6A3 and 6A3 to 1A1 are protective against 28-day and 90-day mortality Additional material Additional ... Additional file 1: Further description of methods, definitions and statistical analysis, and Tables E1-E4 The file contains additional information on exclusion criteria and definitions of PSI, ARDS...
- 12
- 278
- 0
THE LOCAL CONCERNS AND STRATEGIES IN CONFUCIAN CLASSICS COMMENTARIES a CASE OF LI GUANGPOS (1651 1723) ANNOTATIONS ON THE RITES OF ZHOU
... see Song Jaeyoon, “Tension and Balance: Changes of Constitutional Schemes in Southern Song Commentaries on The Rituals of Zhou”, in Benjamin Elman and Martin Kern (Eds), Statecraft and Classical ... support and concern I have truly benefited from his lectures and seminar classes since my undergraduate years His signature question “So what?” had a great impact on me and have served as a constant ... issues of the local government and the drainage system Li’s rationalization of the local official positions mentioned in the “Office of Earth” revealed that he understood these positions as being occupied...
- 196
- 176
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ