supervisor s performance appraisal form is considered a first draft the supervisor shares
Shooting for Tiger How Golf’s Obsessed New Generation Is Transforming a Country Club Sport pptx
Ngày tải lên :
08/03/2014, 20:20
... Although Americans dominate junior tournaments, Europeans and Asians are increasingly visible at AJGA events As golf cast a spell over millions, it has spawned a serious backlash One criticism ... English-speaking countries such as Australia, and more recently to places as far removed as Sweden and Spain, and China and South Korea Today it s a global passion, with professionals from all over the ... Mahatma Gandhi, Muhammad Ali, and Nelson Mandela But Woods insisted he was misquoted on each occasion The greatest misconception the public seems to have of me is that I am a dominating, possessive,...
- 287
- 332
- 0
Tài liệu The Insider’s Guide to PR: Chapter 4 A PR LIFE – THE LADDER, THE PAY AND THE LIFESTYLE doc
Ngày tải lên :
13/12/2013, 04:15
... Getting results is always satisfying Setting up a photocall and then seeing it in the papers the next day is a great buzz.” Laura Manley Account Executive Text 100 English Literature and PR graduate ... get them into six articles in the Financial Times – they take this stuff home to show their kids – it is mad!” Anthony Scammell Account Manager Golin/Harris International English Literature/Sociology ... marketing campaigns within Europe for our client Philips This means the PR work that we is interwoven from start to finish with the advertising and promotional campaigns It is particularly satisfying...
- 2
- 641
- 1
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc
Ngày tải lên :
29/03/2014, 07:20
... produce its natural and blessed effects Within the last five years, British industry has re-established itself upon a basis of sound, solid, and substantial prosperity, such as had hitherto been ... our National Banks The establishment and success of the First Bank of the United States gave a new impulse to the business of banking That same year, the Maryland Bank went into operation at Baltimore, ... match for the political prejudices of Eastern capitalists, a most striking proof that avarice is a passion less strong than hate But in the Middle and Southern states, where the war was popular,...
- 78
- 775
- 0
Is there a silver lining? The Indian mutual fund industry pot
Ngày tải lên :
30/03/2014, 15:20
... of this report Team Members: Anuradha Sanghavi Arun Swaminathan Avinash Kalia H.Sadhak Gautam Mehra Harsh Bisht Jesal Lakdawala Malvika Singh Nehal D Sampat Nidhi Jain Sneha Bhagat Trisha Chatterji ... disposal of schemes If we look at cost structures within the industry, the salary cost, perhaps, is the single largest block In a stress scenario, such as the current situation, there may be a ... separate fund manager for each fund managed by it unless the investment objectives and assets allocations are the same and the portfolio is replicated across all the funds managed by the fund manager...
- 28
- 412
- 0
Báo cáo y học: "Is there a dysfunction in the visual system of depressed patients" pptx
Ngày tải lên :
08/08/2014, 21:20
... scales have a different rational in assessing the 'endogenous-melancholic' and the 'neurotic' syndromes of depression The General Assessment of Functioning Scale (GAF) [22] was used to assess ... Scale (HAS) [21] and their subscales The assessment of the endogeneity of depression was achieved with the use of the Newcastle Scales (1965 Newcastle Depression Diagnostic Scale-1965-NDDS and 1971 ... the Oslo Area (60o N) Acta Psychiatr Scand 1993:111-120 Allen JM, Lam RW, Remick RA, Sadovnick AD: Depressive Symptoms and Family History in Seasonal and Nonseasonal Mood Disorders Am J Psychiatry...
- 10
- 484
- 0
Báo cáo y học: " Mechanical ventilation in the ICU- is there a gap between the time available and time used for nurse-led weaning?" pot
Ngày tải lên :
13/08/2014, 23:20
... Anaesthesia and Intensive Care Anaesthesiologists work as ICU physicians The daytime medical staff consists of two senior ICU physicians (including the medical director) as well as 1–2 anaesthesiology ... performed a multivariate analysis using logistic regression (SPSS, version 15) Pearson 's chi-squared test was used to test for differences in proportions across categorical variables and Mann-Whitney ... 1) The forth criterion (weaning prescribed by a physician) was analysed as a systemic factor Ethical considerations We collected data from the ICU quality assurance database as well as ICU patient...
- 8
- 338
- 0
Báo cáo y học: "A first-draft human protein-interaction map" doc
Ngày tải lên :
14/08/2014, 14:21
... parameters: the quality of the original model organism interaction datasets; and the ability to identify the human orthologs of a model organism protein Our analysis suggests that the raw yeast and ... available in Additional data file available online with this article and can also be searched or downloaded from our website [12] Assessment of the accuracy of the interaction datasets In the absence ... yeast protein interactions as those identified more than once by any single assay, consistent with previous analyses of the individual datasets [1-3,11] As shown in Figure 2a and Table 1, for all...
- 9
- 266
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
Ngày tải lên :
26/10/2012, 10:04
... electrophoresis parameters were set according to the manufacturer s protocol Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA ... (χ2) analysis Differences in the clinical data between the EH and NT groups were assessed by analysis of variance (ANOVA) The distributions of 148 the genotypes or alleles between EH patients and ... systemTM; Agilent Technologies, Waldbronn, Germany) Int J Med Sci 2007, Statistical analysis Data are presented as the mean ± SD The Hardy-Weinberg equilibrium was assessed by doing chi-square...
- 7
- 612
- 1
The PERFORMANCE APPRAISAL QUESTION and ANSWER BOOK: A SURVIVAL GUIDE FOR MANAGERS
Ngày tải lên :
23/10/2013, 10:15
... performance 6 The Performance Appraisal Question and Answer Book Motivating Superior Performance This is another classic reason for having a performance appraisal system Performance appraisal ... website, www.PerformanceAppraisal.com The PERFORMANCE APPRAISAL QUESTION and ANSWER BOOK Chapter The Importance of Performance Appraisal 1.1 What is ‘ performance appraisal ’? Performance appraisal ... individual s performance thus far against the plans and goals that they discussed in the performance- planning meeting Phase 3: Performance Assessment As the time for the formal performance appraisal...
- 255
- 853
- 5
Tài liệu The Decline in the U.S. Personal Saving Rate: Is It Real and Is It a Puzzle? pptx
Ngày tải lên :
16/02/2014, 11:20
... revised Besides these general limitations of the standard BEA and NIPA saving rate measures, a number of statistical and measurement issues have been debated in the literature on the U .S saving rate ... DECLINE REAL? MEASUREMENT ISSUES There are two basic sources of calculated values for the personal saving rate: the NIPA estimates from the BEA and the estimates of the changes in personal net wealth ... major swings in the saving rate The FoF Measure of the Personal Saving Rate Estimates of the assets and liabilities of the personal sector are available in the FoF accounts of the Federal Reserve...
- 24
- 500
- 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx
Ngày tải lên :
16/03/2014, 23:20
... c-secretase assays, an in vitro assay using COS7SPC99-3FLAG CHAPSO extracts was developed The substrate in this assay is synthesized, processed, and trafficked in the cell and would theoretically ... IC50 values of 22 and lm Zn Using two assay systems, these results show that zinc can inhibit in vitro c-secretase cleavage of an APP substrate Discussion The amyloid hypothesis of AD states that ... collected and aliquots assayed for c-secretase activity using exogenous MC99-3FLAG substrate and phospholipids Gamma-secretase activity was measured by densitometry as described Gamma-secretase activity...
- 14
- 420
- 0
Additional Measures Needed to Assess 7(a) Loan Program’s Performance potx
Ngày tải lên :
23/03/2014, 04:21
... impact of SBA assistance on the number and success of small business start-ups, (2) maximizing the sustainability and growth of existing small businesses that receive SBA assistance, and (3) significantly ... firms assisted Source: GAO analysis of SBA s fiscal years 2006 and 2007 Budget Request and Performance Plan and fiscal year 2006 PAR By having quantifiable goals, all of the performance measures ... veterans, handicapped individuals, women, African Americans, Hispanics, Native Americans, and Asians The 7 (a) program also includes provisions for extending financial assistance to small businesses...
- 72
- 294
- 0
a study of the market's reaction to superior sustainability reporting as demonstrated by the financial performance of publicly traded companies
Ngày tải lên :
03/06/2014, 00:48
... non-causal relationship between sustainability and risk and reward as the variables of interest Sustainability was considered as a manifestation of ethical leadership due to the fact that both sustainability ... promote their lack of ethics and once that lack of ethics is discovered the firm s value is destroyed The research sought to establish transparency and enhanced disclosure as best in class business ... two forms of risk, the risk associated with the market in general and the risk associated with the business decisions and operations of the firm (Burton, 1998) A company s securities are evaluated...
- 145
- 431
- 0
báo cáo sinh học:" The effects of performance appraisal in the Norwegian municipal health services: a case study" pdf
Ngày tải lên :
18/06/2014, 17:20
... as a result This suggests the following hypothesis: Hypothesis Self-assessment, professional learning and job motivation increase when employees participate actively in the performance appraisal ... Kirkpatrick DL: Training and Performance Appraisal - Are they Related? Improving Employee Performance Through Appraisal and Coaching 2006 65 Kuvaas B: Performance Appraisal Satisfaction and Employee ... motivation have high mean values for all respondents in the analysis This means that H5 is supported for self-assessment Discussion and evaluation The purpose of this study was to explore goal setting,...
- 12
- 572
- 0
Let''''s face it -- English is a crazy language pps
Ngày tải lên :
12/07/2014, 15:20
... does a freedom fighter fight? If a horsehair mat is made from the hair of horses, from what is a mohair coat made? A slim chance and a fat chance are the same, as are a caregiver and a caretaker, ... trunks at the same time That 's why brassiere is singular but panties is plural That 's why there 's a team in Toronto called the Maple Leafs and another in Minnesota called the Timberwolves That 's ... speak the same English? How can it be easier to assent than to dissent but harder to ascend than to descend? Why is it that a man with hair on his head has more hair than a man with hairs on his...
- 6
- 297
- 0
Business English Lesson – Advanced Level''''s archiveEmployee Performance Appraisal pptx
Ngày tải lên :
26/07/2014, 15:21
... that might restrict their capacity to employees or decrease pay degrade derogate dismiss downsize Whether this is an appropriate use of performance appraisal — the assignment and justification ... are many sources — researchers, management commentators, psychometricians — who have expressed doubts about the validity and reliability of the performance appraisal process disputable disputed ... rewards and penalties — is a very uncertain and matter; few issues in management stir up more controversy than performance appraisal contentious licentious pretentious tendentious There are...
- 9
- 296
- 0
Báo cáo y học: "Is fibromyalgia a cardiovascular disease? A comment on Martinez-Lavin’s review ‘Stress, the stress response system, and fibromyalgia’" ppsx
Ngày tải lên :
09/08/2014, 10:21
... and cardiac output, and increased vascular resistance during static handgrip exercise in postural tachycardia syndrome Am J Physiol Heart Circ Physiol 2007, in press Loevinger BL, Muller D, Alonso ... potential sources of conflicts of interest References Martinez-Lavin M: Biology and therapy of fibromyalgia: Stress, the stress response system, and fibromyalgia Arthritis Res Ther 2007, 9:216 Fontenele ... Fibromyalgia and related medically unexplained symptoms: a lost link between cardiovascular and nociception modulation? J Musculoskeletal Pain, in press Stewart J, Taneja I, Medow MS: Reduced central...
- 2
- 224
- 0
Báo cáo y học: "Poland’s syndrome and recurrent pneumothorax: is there a connection" pps
Ngày tải lên :
10/08/2014, 09:23
... of the surgical team and controlled the paper; KK was the anesthesiologist in one of the cases and controlled the paper; KS was the anesthesiologist in on of the cases and controlled the paper; ... the patients after the operation attending physicians is justified Whether this clinical suspicion also justifies the routine performance of thorax CT to all patients with Poland s syndrome is ... performed as an ophthalmologist ocular control in both cases and performed the related literature research; MD performed literature research and controlled linguistically the paper; AH was a member...
- 2
- 326
- 0