studies the data from which may be included in the regulatory submission for a new drug entity considered gmp studies
Analyzing the markets opportunity for a new product the case of thread deformed bar steel of vina kyoel steel company
Ngày tải lên :
22/10/2015, 13:23
... since errors can lead to inaccurate and misleading data In this case, a sample was a good solution; sample was defined as a small percentage of a population In this research, the population was ... contracts, and even shifts in the controlling political party International laws, such as trade agreements and tariffs, may affect the supply and demand chains and available markets for many different ... defined Human wants are the form taken by human needs as they are shaped by culture and individual personality A hungry person in Bahrain may want a vegetable curry, mango chutney and lassi A hungry...
- 83
- 425
- 0
the method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative merits and limitations
Ngày tải lên :
17/02/2014, 13:02
... When the net annual cash inflow is the same every year, the following formula can be used to calculate the payback period (accountingformanagement.com) *Formula: Payback period = Cash outlay (investment)/ ... processes, and databases This is defensible knowledge base that gives a company a competitive advantage, and is one of the best reasons to acquire a company • International alternative A company may have ... Average Annual Investment Or ARR = − (Increase in expected average operating income/ Initial increase in investment) ARR is related with conventional accounting models of calculating income and...
- 17
- 575
- 0
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
Ngày tải lên :
13/08/2014, 03:20
... sequences are listed in Table Available online http://ccforum.com/content/10/5/R139 Table Locus DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC ... Correlation matrix of asymmetrical dimethyl arginine (ADMA) and inflammatory markers Variation in asymmetrical dimethyl arginine (ADMA) levels with carriage of specific alleles at DDAH II -449 Parameter ... percentages in parenthesis or as medians with interquartile ranges in parenthesis IL6 was measured in pg/ml, asymmetrical dimethyl arginine (ADMA) in µmol/l, lactate in mmol/l, and mean arterial...
- 7
- 265
- 0
Integrated Analysis of Data from MRC Fisheries Monitoring Programmes in the Lower Mekong Basin
Ngày tải lên :
14/03/2014, 08:47
... 800 m before rejoining the main channel another 600 m downstream of the falls in Northern Cambodia Water depths in the predominantly bedrock channel vary between 0.5 m Page 13 Integrated Analysis ... Borikhamxay Paksan Ban Xinh Xay Main River Cambodia Stung Treng Siem Pang Pres Bang Tributary Cambodia Stung Treng Talarborivat Ou Run Main River Cambodia Ratanakiri Veounsai Banfang Tributary Cambodia ... Cambodia Ratanakiri Lum Phat Day Lo Tributary Cambodia Kra Tie Sambo Koh Khne Main River Cambodia Kandal Ponhea Leu Sang Var Flood Plain Viet Nam An Giang Thoai Son Tay Son Flood Plain Combined, the...
- 154
- 604
- 0
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx
Ngày tải lên :
22/03/2014, 23:20
... visiting researcher Among others under certain conditions visiting researchers have access to a wide range of data in the Bundesbank They include micro data on firms and banks not available in the ... Barry Williams and the participants at the Deutsche Bundesbank's research seminar and the SGF 2008 Annual Meeting for helpful comments The banking crises in the US during the eighties and early ... on the tracking banks of German savings banks and cooperative banks It turns out that a sharp decrease in the steepness of the yield curve has the most negative impact on the banks' interest income...
- 40
- 468
- 0
Báo cáo y học: "Inhibition of antithrombin by hyaluronic acid may be involved in the pathogenesis of rheumatoid arthritis" potx
Ngày tải lên :
09/08/2014, 06:22
... factor via NF-kappa B activation in synovial fibroblasts Ann Rheum Dis 1999, 58:55-60 Shin H, Nakajima T, Kitajima I, Shigeta K, Abeyama K, Imamura T, Okano T, Kawahara K, Nakamura T, Maruyama ... 23 Nagaya H, Yamagata T, Yamagata S, Iyoda K, Ito H, Hasegawa Y, Iwata H: Examination of synovial fluid and serum hyaluronidase activity as a joint marker in rheumatoid arthritis and osteoarthritis ... concentration of hyaluronan was not increased in the rheumatoid synovium Their histochemical staining also showed that hyaluronan was concentrated in the lining layer of noninflamed synovial membrane...
- 6
- 437
- 0
Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps
Ngày tải lên :
10/08/2014, 09:21
... showing complete replacement of ascending aorta and aortic arch, the FET in the descending thoracic aorta and the saphenous vein grafts originating from the ascending aorta (b.) Axial CT image ... and muscle relaxant Invasive monitoring included the use of right radial and left radial arterial lines, a pulmonary artery catheter and a foley catheter with temperature probe to measure bladder ... prosthesis attached proximally to the sinotubular junction and distally to the arch prosthesis The proximal anastomoses of the saphenous vein grafts were created in the ascending aorta graft The...
- 5
- 571
- 0
Báo cáo y học: "Noninvasive mechanical ventilation may be useful in treating patients who fail weaning from invasive mechanical ventilation: a randomized clinical trial" pps
Ngày tải lên :
13/08/2014, 10:20
... weaning ventilation methods Cost evaluation should also be included in these studies ing Therefore, NPPV is a useful and safe strategy that may be considered during mechanical ventilation weaning ... [32] Weaning failure during SBT in our study was not an infrequent clinical situation in patients on mechanical ventilation for an average of 7.3 days and was observed in 41.7% of the cases, which ... trial, which indicates that the groups had very similar baseline conditions These findings indicate that NPPV is at least as safe a strategy as IMV There were significantly fewer complications in...
- 8
- 233
- 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
Ngày tải lên :
15/03/2015, 21:24
... thông tin 11 Đèn báo sấy nóng bugi/dầu diesel 12 Đèn cảnh báo trời sương giá 13 Đèn báo bật công tắc kh a điện 14 Đèn báo ch a kh a không nằm ổ 15 Đèn cảnh báo kh a bấm điều khiển từ xa hết pin 16 ... nhấn chân phanh 19 Đèn báo kh a vô-lăng 20 Đèn báo bật đèn pha 21 Đèn báo áp suất lốp mức thấp 22 Đèn báo thông tin đèn xi-nhan 23 Đèn báo lỗi đèn ngoại thất 24 Đèn cảnh báo đèn phanh 25 Đèn cảnh ... Đèn sương mù (sau) Đèn cảnh báo nước r a kính mức thấp Đèn cảnh báo má phanh Đèn báo bật hệ thống điều khiển hành trình Đèn báo rẽ Đèn báo cảm ứng m a ánh sáng Đèn báo chế độ lái m a đông 10 Đèn...
- 3
- 508
- 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
Ngày tải lên :
15/03/2015, 21:25
... least far/farther(further) /the farthest (the furthest) Double comparison(So sánh kép) + Same adj: Short adj:S + V + adj + er + and + adj + er Long adj:S + V + more and more + adj Vd: The weather ... appointment, make a decision, make love… To have dinner, have a party, have a holiday… To some work, a job, homework,… III Cách sử dụng in on at thời gian At: mốc thời gian cụ thể Vd: At 6:00am, ... which, what, who, why, how often Chú ý câu hỏi – trả lời phải phù hợp (Xem sgk p 7) II Các danh từ kèm động từ make, have, To make a phone call, make an arrangement, make a mistake, make an appointment,...
- 7
- 425
- 0
Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx
Ngày tải lên :
11/08/2014, 08:21
... manuscript All authors have read and approved the final manuscript Competing interests AH is a Director of Adjuvantix Ltd and also holds some stock in Adjuvantix Adjuvantix Ltd have an interest in CD40mAb ... showed the same difference in kinetics between CD40 and the other two adjuvants CD40mAb-OVA conjugate induces a more rapid IgG response in mice than either the established adjuvant, alum, or the newer ... Efficacy of human papillomavirus (HPV)-16/18 AS04-adjuvanted vaccine against cervical infection and precancer caused by oncogenic HPV types (PATRICIA): final analysis of a double-blind, randomised...
- 3
- 245
- 0
Báo cáo y học: " A mechanistic model of infection: why duration and intensity of contacts should be included in models of disease spread" ppt
Ngày tải lên :
13/08/2014, 16:20
... constant for all contacts Then, we analyse the impact of contact intensity in a qualitative way Information on shedding rates and inter-individual differences is available for many diseases (e.g., ... this paper 12 Additional material Additional file Contact Data This additional file contains the processed empirical contact data that was used for calculating the results presented in this paper ... disease spread and combining them with an a posteriori, statistical approach: Often data is available that allows fitting a simulation model that includes such mechanistic elements to empirical data, ...
- 10
- 346
- 0
Extending past research in extra role behavior unleasing a new paradigm from the prism of knowledge sharing and whistleblowing
Ngày tải lên :
12/09/2015, 11:24
... “Kakukaka”, Prashant, Kalpesh, Jyotiben, Yogita, Nikita, Harshit, Hemali, Kajal and Viral for all their untiring efforts in getting companies to participate in my survey All and above, I thank ... Alpha, Means, Page No 45 and Standard Deviation Table 2: Repeated Measures ANOVA: Intention to Share 46 Information Table 3: Means, Standard Deviations and Confidence 48 Intervals for the –way ... performance appraisal vs performance bonuses in facilitating knowledge sharing as well as the moderating roles of impression management, Machiavellianism, and the potential beneficiaries of the...
- 217
- 492
- 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
Ngày tải lên :
21/02/2014, 01:21
... nonsulfated glycosaminoglycans (GAGs) from the supernatant were estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the ... as a mole percent, represent the average of at least three independent determinations The amount of protein in each extract was calculated from the amino acids’ molar yields Glycosaminoglycan analysis ... kDa) and lysozyme (17 kDa) resolved for EDTA-SM than for WSM (Fig 2) The main peak from each separation, indicated by an asterisk in Fig 2, was collected and submitted to amino acid analysis Amino...
- 10
- 731
- 0
Research Program of the Partnership for a New Generation of Vehicles doc
Ngày tải lên :
06/03/2014, 15:20
... Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National Laboratory, and ... Program Officer ALAN CRANE, Program Officer MARTIN OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, ... to regulation; however, these data are important as they establish a database for evaluation relative to the findings of current investigations into the possible link between particulate composition...
- 134
- 466
- 0
The Business Case for a Healthy Workplace potx
Ngày tải lên :
15/03/2014, 20:20
... above was an early warning for employers in Ontario, since then the number of such cases has increased, as have the dollar The Business Case for a Healthy Workplace © IAPA (Industrial Accident ... that it cannot be assumed that all acceptable safety measures are contained in this material or that additional measures may not be required in the conditions or circumstances that are applicable ... global workforce: Attracting, retaining and engaging employees for competitive advantage.” 2005 Publication TP449-05, page 57 The Business Case for a Healthy Workplace © IAPA (Industrial Accident...
- 17
- 673
- 2
Reserve Recruiting and the College Market - Is a New Educational Benefit Needed doc
Ngày tải lên :
23/03/2014, 02:20
... number of uncorrelated variables, called principal components, while maintaining the variability in the original variables More specifically, a principal component is a linear combination of the ... serve as the basis for a new AFQT norm beginning July 2004 Because the official DoD norm using the 1997 cohort was not available at the time of our study, and because the 1979 and 1997 cohort ASVAB ... percent, according to the 2000 RCS) in fact obtain a college degree by age 30 While the rate of college attendance has remained fairly constant for males overall since 1980, educational attainment among...
- 97
- 270
- 0
The Seven Rays Today - A New Appreciation of the Ageless Wisdom and Esoteric Astrology pdf
Ngày tải lên :
28/03/2014, 23:20
... ideas may appear to contradict those of today THE SEVEN RAYS TODAY The Seven Rays are the basis of all creation Their highest form of manifestation is in distant star formations, and from certain ... a new way All life consists of the life-force, consciousness and form The life-force maintains the energy of the life of the entity whilst the consciousness and the form maintain an equal balance ... rather than as dogmatic fact This book is an example of how anyone can search inside themselves to find their own answers that are correct for them at their particular point of spiritual awareness,...
- 386
- 560
- 1
War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? docx
Ngày tải lên :
29/03/2014, 03:20
... War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? Summary The high costs of fighting the wars in Iraq and Afghanistan have rekindled congressional interest in the ... of financial institutions Today, savings bonds are almost always a substitute mechanism for other forms of personal savings Author Contact Information James M Bickley Specialist in Public Finance ... Congressional Research Service War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? Introduction The high costs of fighting the wars in Iraq and Afghanistan have rekindled...
- 7
- 361
- 0
Accompanying the document Proposal for a REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on European Social Entrepreneurship Funds doc
Ngày tải lên :
30/03/2014, 12:20
... social businesses are in almost all cases SMEs, the financing patterns in the SME sector as explored in the VC IA also apply to them For SMEs, financing typically varies in nature and balance as enterprises ... grant-based or public financing and their adaptation to it The transition into a 'conventional' financial landscape may be particularly challenging for social businesses compared to other businesses, ... growth in all its forms Sustainable and inclusive growth has a particular and vital role to play The social business initiative is therefore a key step in this agenda, as set out in the Single Market...
- 85
- 798
- 0