structure function relationships of hydrophobic proteins sp b and sp c in pulmonary surfactant

Báo cáo khoa học: New insights into structure–function relationships of oxalyl CoA decarboxylase fromEscherichia coli pptx

Báo cáo khoa học: New insights into structure–function relationships of oxalyl CoA decarboxylase fromEscherichia coli pptx

Ngày tải lên : 06/03/2014, 11:20
... degree of < /b> accordance, except for ThDP–acetyl CoA–EcODC The scattering patterns of < /b> the latter not match any of < /b> the crystal structures, indicating that binding of < /b> acetyl CoA may induce changes in the ... view of < /b> the crystal structure < /b> of < /b> EcODC (A) Schematic representation of < /b> the EcODC monomer Yellow arrows indicate b sheets, and cylinders indicate helices (green, PYR domain; blue, R domain; pink, ... Crystal structure < /b> of < /b> EcODC complexes Overall structure < /b> Holo-EcODC (ThDP-EcODC) was crystallized in the absence of < /b> additional ligands (PDB ID 2q27) and in complex with either ADP (2q28) or acetyl CoA...
  • 13
  • 435
  • 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Ngày tải lên : 08/03/2014, 02:20
... site of < /b> ScPDC and is decarboxylated Differences between the catalytic cleavage of < /b> indolepyruvate by ScPDC and EcIPDC can be found in the substrate affinity and in the reaction rate vs substrate concentration ... pyruvate decarboxylation Examination of < /b> the decarboxylation of < /b> indolepyruvate by ScPDC and ZmPDC The ability of < /b> ScPDC and ZmPDC to decarboxylate indolepyruvate was tested In the case of < /b> ZmPDC no catalytic ... enzymatic activity at a concentration of < /b> 0.5 mM [7] Below, results on fast kinetics, substrate specificity, and cofactor binding of < /b> EcIPDC are presented For the kinetic measurements a continuous optical...
  • 10
  • 430
  • 0
Structure function relationships of variegin a novel class of thrombin inhibitors

Structure function relationships of variegin a novel class of thrombin inhibitors

Ngày tải lên : 14/09/2015, 14:11
... 4.3.5.6 Inhibition of < /b> thrombin amidolytic activity by DV24K10R 173 4.3.5.7 Optimization of < /b> thrombin-s-variegin interactions: removal of < /b> backbone kink 176 4.3.5.8 Inhibition of < /b> thrombin amidolytic activity ... 4.9 Thrombin inhibitory activity of < /b> DV24K10R 175 Table 4.10 Optimization of < /b> thrombin-s-variegin interactions: removal of < /b> backbone kink 178 Table 4.11 Thrombin inhibitory activity of < /b> DV23 and DV23K10R ... protein C APTT activated partial thromboplastin time AT-III antithrombin-III AvGI Amblyomma variegatum Gene Index BPTI bovine pancreatic trypsin inhibitor BSA bovine serum albumin CD circular dichroism...
  • 283
  • 681
  • 0
Structure function studies of vesicle associated membrane protein associated protein b (VAPB) associated with amyotrophic lateral sclerosis (ALS

Structure function studies of vesicle associated membrane protein associated protein b (VAPB) associated with amyotrophic lateral sclerosis (ALS

Ngày tải lên : 12/10/2015, 17:34
... EphA4 and EphB2 receptors, which can also bind ephrin-Bs and ephrin-A5, respectively, and EphB4, which preferentially binds ephrin -B2 only (Elena, 2010) Multiple Ephrins and Eph receptors including ... -1cm-1), l =path length of < /b> cuvette (cm) and c= protein concentration (M)] 2.10 Circular Dichroism (CD) spectroscopy The secondary structure < /b> of < /b> all the recombinant proteins < /b> were determined with a Far ... protein A /B/ C VAPB-2 VAMP-associated protein B protein lacking exon VAPB-4, VAMP-associated protein B protein exons and VAPB-3 VAMP-associated protein B protein exon VAPB-3, VAMP-associated protein...
  • 102
  • 585
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Ngày tải lên : 16/02/2014, 14:20
... heteronuclear NMR spectroscopy (PDB code: 2j2s) A cartoon of < /b> the protein backbone is shown with zinc ions represented as spheres The surfaces of < /b> amino acid residues perturbed by DNA binding in chemical ... Journal compilation ª 2010 FEBS M S Cosgrove and A Patel MLL1’s interaction to the KIX or CREB-binding domain of < /b> CBP [31] The KIX domain of < /b> CBP is a structural platform that is capable of < /b> binding ... ligands (Fig 1B) Structures that have been determined include the MLL1 CXXC domain [22], a portion of < /b> the MLL1 TAD bound to the KIX domain of < /b> the cAMP response element-binding (CREB) binding...
  • 11
  • 761
  • 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): structure–function relationships docx

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): structure–function relationships docx

Ngày tải lên : 16/02/2014, 15:20
... role in modulating the stability of < /b> the metal–thiolate cluster and conformation of < /b> the b- domain by domain–domain interactions, thus altering zinc homeostasis in the brain and in uencing the bioactivity ... Journal compilation ª 2010 FEBS Z. -C Ding et al Structure< /b> reactivity function < /b> study of < /b> GIF A1 B1 A2 B2 Fig (A1) and (A2) Simulated structure < /b> of < /b> the b- domain of < /b> rlMT2 (B1 ) and (B2 ) Predicted structure < /b> ... Moreover, spectroscopic and biochemical studies Structure< /b> reactivity function < /b> study of < /b> GIF showed that the whole structure < /b> and dynamic properties of < /b> sGIF, as well as the solvent accessibility and stability...
  • 9
  • 552
  • 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Ngày tải lên : 18/02/2014, 06:20
... α-amino-β-carboxymuconateε-semialdehyde decarboxylase (ACMSD) COOH CHO N COOH Quinolinic acid COOH NH2 α-aminomuconic acidε-semialdehyde (AMS) non enzymatic Glutaryl CoA N COOH Picolinic acid NAD CO2 + ATP ... which may be considered a unique trait of < /b> ACMSDs The metal centre and the ligand binding site The hACMSD active site is located in a crevice on the protein surface at the C- terminal opening of < /b> ... residue for catalysis, not only because it contributes to Zn2+ coordination but also because of < /b> its direct involvement in substrate binding (Fig 3A ,B) Indeed, as detailed above, Asp291 stabilizes...
  • 9
  • 796
  • 0
Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

Ngày tải lên : 19/02/2014, 12:20
... GCCSDPRCNMNNPDYC* GCCSHPACAGNNQHIC* IRDcCCSNPACRVNNOHVC RDPCCSNPVCTVHNPQIC* GGCCSHPACAANNQDYC* GCCSYPPCFATNSDYC* GCCSYPPCFATNSGYC* GCCSYPPCFATNPD -C* GCCSDPRCAWR C* ACCSDRRCRWR C* m/n nAChR subtype IC50 ... a 4b2 , no change for others [16] no significant change GCCSLPVCHLEHSNLC* a 3b2 d fl [53] GCCSDPRCAWE C* GCCSDPLCAWR C* GCCSNPRCAWR C* GCCSDPACAWR C* GCCSDPRCAWR C* GCCSYPPCFATNPD -C* GCCSLPPCALNNPDYC* ... The cysteine residues are highlighted in bold Conotoxin MII PnIA PnIB EpI GIC GID PIA AnIB AuIA AuIC AuIB ImI ImII a Sequence GCCSNPVCHLEHSNLC* GCCSLPPCAANNPDYC* GCCSLPPCALSNPDYC* GCCSDPRCNMNNPDYC*...
  • 7
  • 492
  • 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure–function relationships ppt

Báo cáo khoa học: Evolutionary changes to transthyretin: structure–function relationships ppt

Ngày tải lên : 07/03/2014, 00:20
... 644–646 11 Bhat MK, Ashizawa K & Cheng SY (1977) Heterogeneity of < /b> chicken prealbumin and specificity in binding to chicken retinol-binding protein and L-thyroxine Indian J Biochem Biophys 14, ... structure < /b> and, as a consequence, in function < /b> of < /b> the binding affinities to T3 and T4 of < /b> transthyretin Speci c residues on the external surface of < /b> transthyretin are involved in the binding to RBP ... [59,63,64] In the binding interaction, RBP and transthyretin each contribute 21 amino acids to the protein–protein recognition interface and most of < /b> these residues are in the C- terminal regions of < /b> the...
  • 12
  • 412
  • 0
Báo cáo khoa học: Synthesis and function of ribosomal proteins – fading models and new perspectives pptx

Báo cáo khoa học: Synthesis and function of ribosomal proteins – fading models and new perspectives pptx

Ngày tải lên : 07/03/2014, 01:20
... regulated by mitogen-induced signal transduction pathways acting through TSC1–TSC2 and involving mTORC1, as suggested by the rapamycin effect Rapamycin, which inhibits mTORC1 by binding to mTOR in a complex ... regulation of < /b> RP mRNAs have remained more elusive In Xenopus, two proteins < /b> have been identified, La and cellular nucleic acid-binding protein (CNBP) ⁄ zinc finger protein (ZNF9), which bind the 5¢-UTRs of < /b> ... case, only in speci c cell types A role of < /b> p53 in mediating the effect of < /b> RP deficiency was also shown in a recent publication by McGowan et al [82] In a chemical mutagenesis screen in mice for pigmental...
  • 12
  • 553
  • 0
Báo cáo khoa học: Structure ⁄function analysis of spinalin, a spine protein of Hydra nematocysts doc

Báo cáo khoa học: Structure ⁄function analysis of spinalin, a spine protein of Hydra nematocysts doc

Ngày tải lên : 07/03/2014, 12:20
... CD spectroscopy and fluorescence spectroscopy The CD spectrum of < /b> spinalin in NaCl ⁄ Tris showed a dichroic minimum centered at 205 nm (Fig 3) The spectrum did not show the presence of < /b> pronounced ... difference between the molecular masses of < /b> the reduced and nonreduced protein indi- A B C D Fig Expression of < /b> spinalin in HEK293 cells and purification of < /b> the recombinant protein Aliquots of < /b> serum-free ... NaCl Proteins < /b> were detected by Coomassie staining (A) or samples were analyzed by western blotting using spinalin antibody (B) Visualization of < /b> nonreduced aggregated spinalin (D) and reduced and...
  • 8
  • 473
  • 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Ngày tải lên : 08/03/2014, 09:20
... are not coincident; however, both structures feature a hydrophobic < /b> patch in the inner region of < /b> the bent, made up by a cluster of < /b> 4/5 aliphatic and/ or aromatic side-chains These findings lend ... Wuthrich, K (1983) Application of < /b> phase sensitive ¨ two-dimensional correlated spectroscopy (COSY) for measurements of < /b> 1H-1H spin-spin coupling costants in proteins < /b> Biochem Biophys Res Comm 113, ... C For estimation of < /b> secondary structure < /b> content, CD spectra were analyzed by a linear combination fit using the reference data of < /b> Greenfield and Fasman [21] NMR spectroscopy Samples for NMR spectroscopy...
  • 7
  • 624
  • 0
Báo cáo khoa học: Structure–function relationship of novel X4 HIV-1 entry inhibitors – L- and D-arginine peptide-aminoglycoside conjugates pptx

Báo cáo khoa học: Structure–function relationship of novel X4 HIV-1 entry inhibitors – L- and D-arginine peptide-aminoglycoside conjugates pptx

Ngày tải lên : 16/03/2014, 06:20
... free aminoglycosides neomycin B, neamine and paromomycin, at concentrations Table Percent inhibition of < /b> 12G5 mAb binding to CXCR4 by R-peptide and their conjugates, and r-peptides and their conjugates, ... achieved by the reaction of < /b> benzylchloroformate (CbzCl) in the presence of < /b> sodium carbonate in high yield Then, the ‘Boc’ group was removed by a classical trifluoroacetic acid cleavage, affording ... step by interacting with CXCR4 Significant differences were found between the antiviral potency of < /b> APACs containing 6- and 9-mers d-arginine, and the two aminoglycosides; neamine and neomycin In...
  • 14
  • 433
  • 0
Báo cáo khoa học: Structure–function analysis of the filamentous actin binding domain of the neuronal scaffolding protein spinophilin pot

Báo cáo khoa học: Structure–function analysis of the filamentous actin binding domain of the neuronal scaffolding protein spinophilin pot

Ngày tải lên : 16/03/2014, 06:20
... 2007 FEBS H Schuler and W Peti ¨ The actin binding domain of < /b> spinophilin A B C Fig Recombinant proteins < /b> containing N-terminal fragments of < /b> rat spinophilin are active in F-actin binding (A) Cosedimentation ... [23,25,26] Both spinophilin and neurabin contain N-terminal filamentous actin (F-actin) binding, PP1 binding, PDZ and C- terminal coiled-coil domains In addition, neurabin, but not spinophilin, contains ... compilation ª 2007 FEBS 63 The actin binding domain of < /b> spinophilin H Schuler and W Peti ¨ Fig Spinophilin F-actin binding domain constructs can crosslink and cap actin polymers Polymers of < /b> actin,...
  • 10
  • 437
  • 0
Báo cáo khoa học: Effect of valine 106 on structure–function relation of cytosolic human thymidine kinase Kinetic properties and oligomerization pattern of nine substitution mutants of V106 ppt

Báo cáo khoa học: Effect of valine 106 on structure–function relation of cytosolic human thymidine kinase Kinetic properties and oligomerization pattern of nine substitution mutants of V106 ppt

Ngày tải lên : 16/03/2014, 16:20
... isoleucine and threonine have one property in common, i.e branching at the b- carbon atom classically considered to destabilize a-helices because of < /b> steric clashes The side chain of < /b> leucine differs ... 5¢-CCATTTGGGGCCATCTAGAACCTGGTGC CGCTG(451–483)-3¢; antisense, 5¢-CAGCGGCACCAG GTTCTAGATGGCCCCAAATGG(483–451)-3¢ The underlined bases were changed in comparison with the original sequence; the stop codon ... template for PCR with a sense primer: 5¢- GGGGGATCCTGCA CACATGACCGGAACACC(247–273)-3¢ designed to contain a GGG overhang and an antisense primer: 5¢-CGGCACCGAATTCTAGATGGCCCCAAATGGC TTCCT(480–445)-3¢...
  • 9
  • 447
  • 0
Báo cáo khoa học: Protein tyrosine phosphatases: structure–function relationships ppt

Báo cáo khoa học: Protein tyrosine phosphatases: structure–function relationships ppt

Ngày tải lên : 30/03/2014, 04:20
... recruiting speci c ligands [4] Structural characteristics of < /b> the PTP catalytic domain The catalytic domain contains 280 amino acids that determine a speci c PTP fold with several characteristic FEBS ... disordered in the crystal structures 1YGR and 1YGU) are shown schematically in red and blue, respectively In the RPTPa D1 crystal structure < /b> (PDB accession number 1YFO) the ‘inhibitory wedge’ blocks access ... Pleiotrophin signals increased tyrosine phosphorylation of < /b> beta beta-catenin through inactivation of < /b> the intrinsic catalytic activity of < /b> the receptor-type protein tyrosine phosphatase beta ⁄ zeta Proc...
  • 16
  • 319
  • 0
Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx

Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx

Ngày tải lên : 30/03/2014, 11:20
... fluorescence of < /b> cells exposed to different concentrations of < /b> peptides, Facetic acid is the fluorescence of < /b> cells exposed to 0.01% acetic acid only, and Fbackground is the background fluorescence of < /b> ... are responsible for each of < /b> the antibacterial, LPS-binding and cytolytic activities of < /b> fowlicidin-1 (Fig 7) The C- terminal a-helix after the kink (residues 16–23), consisting of < /b> a stretch of < /b> eight ... 3271.1 instead highly concentrated at both ends To probe the impact of < /b> N- and C- terminal cationic regions and two short helical segments on antibacterial, LPS-binding, and cytolytic activities of...
  • 13
  • 386
  • 0
Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx

Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx

Ngày tải lên : 12/08/2014, 23:21
... histocompatibility complex (MHC) class I and II, lymphotoxin, chemokine (C- C motif) ligand (CCL) 3, CCL4, CCL5, interleukin (IL)-12 and tumor necrosis factor (TNF) [51] Interaction of < /b> Tat with integrins ... Beclin-1 possesses a BH3 domain that interacts with the BH3 receptor domain of < /b> the anti-apoptotic proteins < /b> of < /b> the Bcl-2 family BH3-only proteins < /b> can induce autophagy by competitively disrupting ... then induce mitochondrial membrane permeabilization resulting in the release of < /b> critical pro-apoptotic intermembrane space effectors into the cytosol such as cytochrome c, apoptosis-inducing factor,...
  • 13
  • 647
  • 0
STRUCTURE-FUNCTION ANALYSIS OF CXXC FINGER PROTEIN 1

STRUCTURE-FUNCTION ANALYSIS OF CXXC FINGER PROTEIN 1

Ngày tải lên : 24/08/2014, 11:05
... ANALYSIS OF < /b> CXXC FINGER PROTEIN This dissertation describes structure-< /b> function < /b> studies of < /b> CXXC finger protein (Cfp1), encoded by the CXXC1 gene, in order to determine the functional significance of < /b> Cfp1 ... at CpG dinucleotides These chromatin modifications in combination with polycomb group proteins < /b> all contribute to and ensure the maintenance of < /b> X inactivation by maintaining a heterochromatic configuration ... transcription factors, including Ap-2, c- Myc/Myn, Creb, E2F, and NF- B, recognize sequences that contain CpG dinucleotides, and binding to each has been shown to be inhibited by methylation (Singal...
  • 301
  • 309
  • 0
Comparatives study on sequence structure function relationship of human short  chain dehydrogenases reductases

Comparatives study on sequence structure function relationship of human short chain dehydrogenases reductases

Ngày tải lên : 23/10/2015, 15:38
... (UCU, UCC, UCA, UCG, AGU and AGC) and Alanine is encoded with four codons (GCU, GCC, GCA and GCG) Hence, the simple way for changing Serine into Alanine is by a single transition of < /b> amino acid, ... row contains the characters of < /b> V and the second the characters of < /b> W Matching characters, in V and W, are placed in the same column and different characters are placed as a mismatch in the same column ... location of < /b> the active and binding sites of < /b> the protein This is because active and binding sites are responsible for any chemical and or enzymatic reactions that happened in the protein molecules...
  • 53
  • 377
  • 0

Xem thêm