steps in finding partial sums of a list straight arrows represent links between elements curved arrows indicate additions

Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx

Ngày tải lên : 20/06/2014, 21:20

... A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law Qunying Wu1,2 College of Science, Guilin University ... establish the ASCLT for self-normalized partial sums of random variables in the domain of attraction of the normal law, we will show that the ASCLT holds under a fairly general growth condition on dk ... be a sequence of independent and identically distributed random variables in the domain of attraction of a normal distribution A universal result in almost sure limit theorem for the self-normalized...

13
480
0

studies of pathogenesis-related proteins in the strawberry plant partial purification of a chitinase-containing protein complex and analysis of an osmotin-like protein gene

Ngày tải lên : 13/11/2014, 09:25

... regulation of SA biosynthesis during SAR (Cao et al., 1997) NPR1 is an ankyrin-repeat containing protein, a domain often involved in protein-protein interactions A subclass of basic region/leucine ... extracellular and show little antifungal activity It seems that extracellular chitinases are involved in generation of signal and transfer of information about infection, whereas vacuolar chitinases ... class III chitinase in Vitis vinifera was first induced in the leaf inoculated with Plasmopara viticola, and induced later in the upper-stage healthy leaf; in contrast, the expression of a class...

119
307
0

Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Ngày tải lên : 15/01/2014, 15:59

... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... (Additive Increase Multiplicative Decrease) • Fair: max-min fairness • Stable: globally asynchronously stable • But, inefficient and not scalable – In grid networks (with high bandwidth-delay product) ... rate on high bandwidth-delay product networks Fairness of TCP Amsterdam 100ms Gb/s Chicago 1ms Chicago 1Gb/s Merge two real-time data streams From Chicago to Chicago 2: 800Mbps From Amsterdam...

32
580
0

Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt

Ngày tải lên : 16/02/2014, 06:20

... sum of paid -in capital and retained earnings It is an index to measure the leverage capacity of financial institutions 20 ADBI Working Paper 380 Prada 2002 for most MDBs and have not since regained ... Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St Kitts and Nevis, St Lucia, St Vincent and the Grenadines, ... Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside the subregion, and; CDB in Anguilla,...

35
481
0

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Ngày tải lên : 19/02/2014, 16:20

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on the left indicates the beginning of the association...

8
494
0

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Ngày tải lên : 07/03/2014, 14:20

... pKa calculations indicate that Glu144 has a slightly elevated pKa in the free enzyme that, at least in part, results from the vicinity of Asp215 (Table 3, rows and 4) The calculations indicate ... cognate alanine mutants were greatly reduced (1 · 103 ) · 104fold) Mutation of Asp140 resulted in a · 103-fold decrease in activity regardless of whether alanine or asparagine was introduced Another ... which appears to be crucial in ChiB and in chitinase A1 from Bacillus circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases [28,30] Preliminary...

10
651
0

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20

... (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) ... obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and ... induced at 15 °C, and from yeast expressing SSTR2 as a control activity By taking advantage of structural and functional similarities between yeast and mammalian GPCR signaling pathways, this assay...

14
473
0

Mastering the Ultimate High Ground -Next Steps in the Military Uses of Space pptx

Ngày tải lên : 15/03/2014, 18:20

... as two separate and distinct operating mediums and mission areas Starting in 1958, a portrayal of air and space as a seamless continuum from the earth’s surface to infinity was advanced by the ... colleague, a kindred spirit, and a special friend of rare warmth ACRONYMS AAF ABM ABMA Army Air Force Antiballistic Missile Army Ballistic Missile Agency ADC Aerospace Defense Command AFM Air ... Technology Integration NACA National Advisory Committee on Aeronautics NAF NASA NORAD NRO Numbered Air Force National Aeronautics and Space Administration North American Aerospace Defense Command National...

207
341
0

A naturalist in Brazil; the record of a year''''s observation of her flora, her fauna, and her people pptx

Ngày tải lên : 15/03/2014, 19:20

... (pELAGIA) A COFFER-FISH A SECTION OF A LIANA STEM LEAF OF THE CLIMBING PALM, JACYTARA YOUNG SHOOT OF THE "cAt's- 45 9° CLAW" CREEPER 93 SECTION OF STEM OF A BAUHINIA BLADDER-TRAPS ON THE ROOTS OF ... it rained once more, but only now and again heavy downpours of rain, to blue sky ; ; ; 23 NATURALIST A and these rains are known IN BRAZIL in North-eastern Brazil as the caju rains, them in order ... than in Portugal The language of the Discoverers, which was nearer Spanish than is the language of to-day, has survived in Brazil it is a language of great beauty, and very musical ; less A NATURALIST...

472
368
0

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Ngày tải lên : 17/03/2014, 10:20

... 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ ... 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ ... 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ 5¢-GACTAGAAGCGGGAACGCCATACGGA-3¢...

12
380
0

Cervical Cancer Screening In Developing Countries - Report Of A WHO Consultation doc

Ngày tải lên : 22/03/2014, 16:22

... programmes of retraining are ideal Participation of the laboratory in an external quality control programme, such as that organized by the Pan-American Health Organization (PAHO) for many Latin American ... (1) Thus although breast cancer is increasing in importance in many developing countries, cervical cancer remains a major cause of morbidity and mortality Data are available internationally on ... available in many high-risk countries of sub-Saharan Africa or in Latin America and South and South-East Asia This is why some investigators are currently evaluating the safety and acceptability of...

89
1.1K
0

Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot

Ngày tải lên : 28/03/2014, 23:20

... Dominica Ecuador El Salvador Granada Guatemala Guyana Haití Honduras Jamaica México Nicaragua Panamá Paraguay Perú República Dominicana Saint Kitts y Nevis San Vicente y las Granadinas Santa Luc a ... PAÍSES INDUSTRIALIZADOS Alemania Andorra Australia Austria Bélgica Canadá Chipre Dinamarca Eslovaquia Eslovenia Espa a Estados Unidos Estonia Finlandia Francia Grecia Hungr a Irlanda Islandia ... Singapur Tailandia Timor–Leste Tonga Tuvalu Vanuatu Viet Nam AMÉRICA LATINA Y EL CARIBE Antigua y Barbuda Argentina Bahamas Barbados Belice Bolivia Brasil Chile Colombia Costa Rica Cuba Dominica...

48
417
0

Cervical Cancer Screening in Developing Countries: Report of a WHO consultation doc

Ngày tải lên : 28/03/2014, 23:20

... programmes of retraining are ideal Participation of the laboratory in an external quality control programme, such as that organized by the Pan-American Health Organization (PAHO) for many Latin American ... (1) Thus although breast cancer is increasing in importance in many developing countries, cervical cancer remains a major cause of morbidity and mortality Data are available internationally on ... available in many high-risk countries of sub-Saharan Africa or in Latin America and South and South-East Asia This is why some investigators are currently evaluating the safety and acceptability of...

89
848
0

Mastering the Ultimate High Ground - Next Steps in the Military Uses of Space docx

Ngày tải lên : 29/03/2014, 15:20

... as two separate and distinct operating mediums and mission areas Starting in 1958, a portrayal of air and space as a seamless continuum from the earth’s surface to infinity was advanced by the ... colleague, a kindred spirit, and a special friend of rare warmth ACRONYMS AAF ABM ABMA Army Air Force Antiballistic Missile Army Ballistic Missile Agency ADC Aerospace Defense Command AFM Air ... Technology Integration NACA National Advisory Committee on Aeronautics NAF NASA NORAD NRO Numbered Air Force National Aeronautics and Space Administration North American Aerospace Defense Command National...

207
253
0

báo cáo hóa học: " Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" potx

Ngày tải lên : 18/06/2014, 19:20

... development of the computer program which had to include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... feedback of HRQoL has as of yet not been widely implemented in clinical practice This may be explained by the initial lack of convincing data regarding the effectiveness of standardized HRQoL measurement...

9
477
0

báo cáo hóa học:" The effect of abductor muscle and anterior-posterior hip contact load simulation on the in-vitro primary stability of a cementless hip stem" ppt

Ngày tải lên : 20/06/2014, 04:20

... resolution was smaller than 0.7 μm in all translational directions, and smaller than 0.001° in rotation The accuracy of the system in measuring translation was evaluated against a micrometer ... significantly affect implant motion, and increasing the Fap to 0.6 BW only gave a significant increase in translational migration in the lateral and distal directions Park et al Journal of Orthopaedic ... migration accounted for 94 to 99% of the total translational migration The average absolute rotational migration was smaller than 0.04° in the sagittal and frontal planes, but much larger in the...

14
400
0

báo cáo hóa học:" Logistic feasibility of health related quality of life measurement in clinical practice: results of a prospective study in a large population of chronic liver patients" pptx

Ngày tải lên : 20/06/2014, 16:20

... development of the computer program which had to include several crucial specifications (instant scoring and graphical output of the data, instant availability of data to physicians, guaranteing patient ... the assessment of the physical, psychological, and social functioning of the patient in terms of the impact of disease is "an essential part of clinical diagnosis, a major determinant of therapeutic ... feedback of HRQoL has as of yet not been widely implemented in clinical practice This may be explained by the initial lack of convincing data regarding the effectiveness of standardized HRQoL measurement...

9
370
0

Báo cáo hóa học: " Research Article Almost Sure Central Limit Theorem for Product of Partial Sums of Strongly Mixing Random Variables" docx

Ngày tải lên : 21/06/2014, 05:20

... product of partial sums, ” Applied Mathematics Letters, vol 19, pp 191–196, 2004 J S Jin, “An almost sure central limit theorem for the product of partial sums of strongly missing random variables,” ... by the National Natural Science Foundation of China 11061012 , Innovation Project of Guangxi Graduate Education 200910596020M29 References G A Brosamler, “An almost everywhere central limit ... variables with zero mean, and let {ak,n , ≤ k ≤ n, n ≥ 1} be a triangular array of real numbers Assume that n sup n k a2 < ∞, k,n max |ak,n | −→ as n −→ ∞ 2.1 1≤k≤n If for a certain δ > 0, {|Xk |2...

9
292
0

Báo cáo hóa học: " Research Article Finding Common Solutions of a Variational Inequality, a General System of Variational Inequalities, and a Fixed-Point Problem via a Hybrid Extragradient Method" ppt

Ngày tải lên : 21/06/2014, 07:20

... Verma, “Iterative algorithms and a new system of nonlinear quasivariational inequalities,” Advances in Nonlinear Variational Inequalities, vol 4, no 1, pp 117–124, 2001 29 L.-C Ceng, C Wang, and ... A, C Nadezhkina and Takahashi 23 and Zeng and Yao 24 proposed extragradient methods motivated by Korpeleviˇ 25 for ﬁnding c a common element of the ﬁxed point set of a nonexpansive mapping and ... generalized strongly nonlinear quasivariational inequalities,” Journal of Mathematical Analysis and Applications, vol 201, no 1, pp 180–194, 1996 13 L.-C Ceng, S Huang, and A Petrusel, “Weak convergence...

22
356
0