start by creating a solid cuboid to act as a starting base for the component
how to get a higher ielts score by building a positive image in the examiner''''''''s mind
Ngày tải lên :
30/07/2014, 12:22
... a brief report on some data and to give some outline views on a social issue as background material to be taken to a two day, academic seminar overseas The lecturer is flying overseas for that ... personal comments Why it? Use a systematic layout Create and arrange other paragraphs logically Why it? Use a professional writing style and formal tone You can try to achieve an appropriate formal, ... each paragraph if the topic sentence is clear, it gives a positive impression to the assessor, because it means the assessor can predict the content of the paragraph more easily In your Task plan:...
- 65
- 433
- 0
Start and run a successful cleaning business the essential guide to buiding a profitable company
Ngày tải lên :
31/03/2017, 11:05
... up all the costs and thus ascertain a realistic starting budget There are also websites that offer start- up cost calculators For example, the Alliance & Leicester has a start- up cost calculator ... happy for the past three years are not actually yours at all – they never have been, in fact The above case study is typical of what can happen, but in other cases people have lost many thousands ... obligation total down to £3,000 Not only that, but also another franchisee has had to pay to take on the two new accounts, which Mr Aslam has already paid for and which are now lost! Three years...
- 193
- 679
- 0
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son
Ngày tải lên :
07/04/2013, 23:51
... relational database power to give all information one needs to make better decisions It integrates data from spreadsheets and other databases and is the easy way to find answers, share information ... interface for service suppliers to update their own database So, there is no immediate link from the application’s database and the database of the suppliers 1.7 Organization of the research • ... permanently It has another advantage to attract tourists It is the location advantage Due to the fact that there is only international airport, which is Noibai airport, in the North of Vietnam...
- 58
- 472
- 0
Tài liệu Module 5: Creating a Security Design for Physical Resources pdf
Ngày tải lên :
21/12/2013, 19:15
... the room and extract an account database from a server by using a boot startup disk or CD The attacker could then perform a brute force attack on the password hashes in the database and access ... disasters such as tornados and hurricanes, and disasters caused by people such as unintentional or accidental acts, and intentional acts like vandalism and terrorism To plan for disaster recovery, ... from the reception area to the mailroom and from the hallway to the mailroom are not equipped with card scanners Private branch exchange (PBX) and wide area network (WAN) room The room has an adjoining...
- 24
- 417
- 0
Tài liệu Module 6: Creating a Security Design for Computers ppt
Ngày tải lên :
21/12/2013, 19:15
... prepare for this module: Read all of the materials for this module Complete the practices Complete the lab and practice discussing the answers Watch the animation Read the additional reading for ... that you remove media from storage devices before disposal Media All data and data artifacts on storage media should be removed before you dispose of the storage media If the information that ... Scenario You are a consultant hired by Contoso Pharmaceuticals to help the company design security for its network Each lab uses an interactive application to convey scenario-based information To...
- 30
- 458
- 0
Tài liệu Module 7: Creating a Security Design for Accounts pdf
Ngày tải lên :
18/01/2014, 05:20
... NTLM Stored as an MD4 hash value of the password LAN Manager Stored as the concatenation, or linking, of the two 7-character halves of the password that are used to encrypt a constant using Data ... and LAN Manager password hash values from the Security Accounts Manager (SAM) database and attack the hashes offline by using commonly available tools To prevent the compromise of these passwords, ... are stored as LSA secrets, which an attacker can extract If the account is a domain account, an attacker who extracts the password from a computer can then log on to the domain Create unique passwords...
- 30
- 352
- 0
Tài liệu Module 8: Creating a Security Design for Authentication docx
Ngày tải lên :
18/01/2014, 05:20
... smart cards to be authenticated Management has asked you to perform a qualitative risk analysis of items in the table For each threat, assign a probability and impact value between and 10, and then ... attacks You can use Group Policy to disable the use of the LAN Manager authentication protocol and to remove the LAN Manager password hashes To disable the use of LAN Manager for authentication, ... that are stored in Active Directory and SAM databases on local computers, and by disabling the use of the LAN Manager authentication protocol These two actions will improve security against attacks...
- 32
- 397
- 0
Tài liệu Module 9: Creating a Security Design for Data pptx
Ngày tải lên :
18/01/2014, 05:20
... the Administrator account in the local Security Accounts Manager (SAM) database The attacker then logs on to the laptop as Administrator and accesses the data Internal attacker scenario An internal ... attackers For example: External attacker scenario An external attacker steals a laptop from an employee’s car Using a floppy disk to boot the computer, the attacker replaces the password of the ... strategy for data helps ensure that your data remains protected Create policies to manage how your organization stores data and backs up data Use auditing to ensure that access to data remains...
- 24
- 340
- 0
Tài liệu Module 10: Creating a Security Design for Data Transmission docx
Ngày tải lên :
18/01/2014, 05:20
... attacker Threats can range from passive monitoring to malicious disruption of traffic For example, an attacker who wants to gain knowledge about data as it is transmitted can passively monitor the network ... data to show that the cost of the certificate and accelerator card is less than the Annual Loss Expectancy (ALE) from exposing customer information to attackers The potential ALE from such attacks ... hired by Contoso Pharmaceuticals to help the company design security for its network Each lab uses an interactive application to convey scenario-based information To begin a lab, on the desktop,...
- 28
- 460
- 0
Tài liệu Module 11: Creating a Security Design for Network Perimeters ppt
Ngày tải lên :
18/01/2014, 05:20
... host Acts as the main connection for computers on the internal network that are accessing the Internet As a firewall, the bastion host is designed to defend against attacks that are aimed at the ... points Assets are vulnerable to threats from both external and internal attackers For example: External attacker scenario An external attacker runs a series of port scans on a network The attacker ... recently deployed a Web server so that employees can retrieve their e-mail messages The IT manager has asked you to explain how a Land attack and a SYN flood attack (or SYN-ACK attack) can prevent users...
- 24
- 535
- 0
Báo cáo khoa học: "Creating a Gold Standard for Sentence Clustering in Multi-Document Summarization" potx
Ngày tải lên :
08/03/2014, 01:20
... almost paraphrases For our task sentences that are not paraphrases can be in the same cluster (see rule 5, 8, 9) In general there are several constraints that pull against each other The judges have ... evaluation of S IM F INDER Hatzivassiloglou et al (2001) created a set of 10.535 manually marked pairs of paragraphs Two human annotator were asked to judge if the paragraphs contained ’common information’ ... summarization to update summaries, where it is assumed that the reader has already read earlier articles about an event and requires only an update of the newer development Since DUC has moved to...
- 9
- 398
- 0
CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx
Ngày tải lên :
22/03/2014, 14:20
... institutionalization (Eng et al., 1997) Other home and community based long term care models also showed increased life satisfaction and social interactions, as well as reduced unmet needs among the ... (1985) National Strategies for Health Care Organization: A World Overview Ann Arbor: Health Administration Press Rothman, J & Sager, J.S (1998) Case Management (2nd Edition) MA: Allyn & Bacon, ... emotional support A local study has shown that a natural locality-based social support by neighbors has generated very positive psychological effects on singleton elderly (Yip, 1994) By encouraging...
- 7
- 507
- 0
Embedded Aesthetics: Creating a Discursive Space for Indigenous Media potx
Ngày tải lên :
30/03/2014, 16:20
... at the head, a young Aboriginal woman who had trained at the Central Australian Aboriginal Media Association (CAAMA) She has been creating programming through the use of work such as Manyu Wana ... sacred aspects of the landscape; they reinforce the social relations that are fundamental to ritual production; and they enhance the place of Pitjantjatjara among Aboriginal groups in the area, as ... 1980s, the demand for more Aboriginal participation and visibility in the Australian mediascape has been increasing, not only for local access to video in remote areas, but also for more Aboriginal...
- 18
- 281
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Bcl2 These data suggest that Treg cells decrease in number by apoptosis due to a deficiency of IL-2 in inflammatory sites [10] Hence, IL-2 may function as critical an anti-apoptotic factor for ... regulatory T cells J Immunol 2003, 171:3348-3352 13 Kumanogoh A, Wang X, Lee I, Watanabe C, Kamanaka M, Shi W, Yoshida K, Sato T, Habu S, Itoh M, et al: Increased T cell autoreactivity in the absence...
- 12
- 573
- 0
Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot
Ngày tải lên :
18/06/2014, 22:20
... at all stages of the project, including organizational and scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final ... allowed all labs to use their own protocol for thawing, staining, gating, and data analysis Each laboratory performed two parallel assays, one with and one without the inclusion of dump channel markers ... individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical data generated and provided by individual laboratories In addition, to minimize...
- 13
- 752
- 0
o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot
Ngày tải lên :
20/06/2014, 04:20
... at all stages of the project, including organizational and scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final ... allowed all labs to use their own protocol for thawing, staining, gating, and data analysis Each laboratory performed two parallel assays, one with and one without the inclusion of dump channel markers ... individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical data generated and provided by individual laboratories In addition, to minimize...
- 13
- 579
- 0
Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx
Ngày tải lên :
22/06/2014, 00:20
... mg catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a flow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for ... min, then CH4 was turned off and the furnace was cooled to room temperature in an Ar flow The impurities were removed by concentrate HCI The Raman spectra were recorded by a Renishaw inVia spectrophotometer ... spectrophotometer at room temperature and in a backscattering geometry, with Ar laser at 514.5 nm Results and Discussion Figure shows the Raman spectra for materials grown at different growth temperature...
- 4
- 395
- 0
báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc
Ngày tải lên :
12/08/2014, 03:20
... Sato S, Nakamura Y, Kaneko T, Asamizu E, Kato T, Nakao M, Sasamoto S, Watanabe A, Ono A, Kawashima K, et al.: Genome Structure of the Legume, Lotus japonicus DNA Research 2008, 15:227-239 Grattapaglia ... B3 Ap32# Ar10 Figure A linkage map for the B-genome of Arachis A linkage map for the B-genome of Arachis Linkage map of Arachis based on an F2 population resultant from the cross A ipaënsis × A ... CENARGEN (Brasília-DF, Brazil) DNA extraction Total genomic DNA was extracted from young leaflets essentially as described by Grattapaglia & Sederoff (1994) [60] The quality and quantity of the...
- 10
- 399
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
Ngày tải lên :
14/08/2014, 21:20
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1 F GCCTTCTACGTTTCCATCCA 1083 ACT1 R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... CAGGGTTTGGCCGATACTTA Primer Alias Sequence 1247 RNR3R CTTCTTTTTGGGCCAATTCA 1280 BNA2 5' CTCGACGCTGATTGGCTAA 1248 YKL161CF TGGCCGAACTACTTGGTAGG 1281 BNA2 3' 1249 YKL161CR GCAATGTTTCCTCAGGTGGT GTAACCAGTACGAAAAAAGATA...
- 17
- 432
- 0
huber & robertson - creating new money; a monetary reform for the information age (2000)
Ngày tải lên :
01/11/2014, 23:02
... managed by banks for their customers, as a basis for the payments services and cash facilities which the banks will provide and manage for them The money in them will no more be part of the bank’s ... control the amounts created by the banks as loans to their customers In fact it should be easier Today the central banks, as central monetary authorities, manipulate short-term interest rates with the ... known as “fractional reserve banking” As Chapter describes, proposals for monetary reform have often advocated 100% banking (in place of fractional reserve banking) as a way to prevent banks creating...
- 107
- 183
- 0