... future Competing interests MRE-B is a translational researcher who has participated in many laboratory and clinical research studies, as well as several successful biotechnology company start-ups, ... thinking along these lines and could serve asa template for commercialization efforts in the percubator [12,13] And asa practical matter, designating percubator investigators and their companies as ... translational approach: a) academia hands off an application to the private sector only if and when it meets a threshold of projected revenues; b) new research findings are published in an academic journal...
... future Competing interests MRE-B is a translational researcher who has participated in many laboratory and clinical research studies, as well as several successful biotechnology company start-ups, ... thinking along these lines and could serve asa template for commercialization efforts in the percubator [12,13] And asa practical matter, designating percubator investigators and their companies as ... translational approach: a) academia hands off an application to the private sector only if and when it meets a threshold of projected revenues; b) new research findings are published in an academic journal...
... Adrie C, Adib-Conquy M, Laurent I, Monchi M, Vinsonneau C, Fitting C, Fraisse F, Dinh-Xuan AT, Carli P, Spaulding C, et al.: Successful cardiopulmonary resuscitation after cardiac arrest asa ... Mashima R, Saeki K, Aki D, Minoda Y, Takaki H, Sanada T, Kobayashi T, Aburatani H, Yamanashi Y, Yoshimura A: FLN29, a novel interferon- and LPS-inducible gene acting asa negative regulator of ... Ziegler-Heitbrock and colleagues [71] demonstrated that endotoxin tolerance in a monocytic cell line was associated with an increase of the inactive p50 homodimer of NF-B and a decrease of the p50p65 active...
... recombined product (pTRE-RLZ) cotransfected with an expression vector for a phage l integrase mutant was set as 100% In each case, data were collected from six separate transfection assays, each employing ... Micrococcal nuclease digestion of nuclei reveals extended nucleosome ladders having anomalous DNA lengths for chromatin assembled on non-replicating plasmids in transfected cells Nucleic Acids ... topoisomerases Histone modifications such as acetylation and phosphorylation play important roles in the regulation of chromatin structure In particular acetylation of the N-terminal tails of histones are...
... of the logarithm of the survival time can be appropriate In this case we can measure the loss Table 2: Classification accuracy and MSE of survival probability predictions on cancer registry dataset ... prediction over the SUPPORT2 dataset and RHC dataset (we omit classification accuracy due to lack of space) The thresholds are again chosen at 25% lower quantile, median, and 75% upper quantile of ... discriminative power (i.e., classification accuracy) of the probability predictions Table shows the classification accuracy and MSE on the predicted probabilities of different models at 5, 12, and...
... Pellemans H (2001) Picosecond farinfrared studies of intra-acceptor dynamics in bulk GaAs and ␦-doped AlAs/GaAs quantum wells Phys Rev B 63(15):155314 20 Flensburg C, Stewart RF (1999) Lattice dynamical ... function as an ion trap, we have measured the temperature dependence of the 2p0 and 2pϮ 1s (A1 ) decay times Fig shows the remarkable result that the decay times actually increase with temperature—more ... donor concentrations of N0 ϳ ϫ 1021 mϪ3 The silicon was ‘‘natural,’’ that is, not isotopically purified ACKNOWLEDGMENTS We thank Engineering and Physical Sciences Research Council (EPSRC) and the...
... (n), and Na+-dependent ATPase activities (m) Each activity was measured at various pressures and 37 Cas described in Experimental procedures Speci c activities of Na+/K+-ATPase, K+-activated ... decreased reaction rate of the Na+/K+-ATPase with an increase in pressure can be rationalized based on a decrease in ¯uidity of the lipid bilayer with a concomitant decrease in protein conformational ... pyruvate kinase, and 2.5 lgámL)1 LDH in a total volume of mL The reaction was initiated by an addition of 50 ng of Na+/K+-ATPase Na+-dependent ATPase activity was also measured using the coupled...
... rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research species, blindsnakes represent a ... depth of coverage, average quality values per contig, discordant read pairs, gene footprint coverage (as assessed by cDNA contigs) and comparative alignments to the most closely related species ... ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation of ancestral gene family copy numbers, instances of differential expansion/contraction of...
... it can increase as GFR decreases All of these factors explain why serum creatinine concentration may not be a good parameter for accurate determination of GFR, especially at lower rates [1] Cystatin ... Critical Care April 2005 Vol No Villa et al Table Demographic characteristics and clinical conditions of 50 critically ill patients at risk for developing acute renal dysfunction Parameter ... cystatin C and serum creatinine for identifying renal dysfunction was evaluated using receiver operating characteristic curve analysis, and the data are expressed as area under the curve (AUC;...
... issue are warranted Competing interests The author(s) declare that they have no competing interests References 532 Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin Casa ... filtration rate in renal transplant recipients Clin Chem 1999, 49:1866-1868 Coll E, Botey A, Alvarez L, Poch E, Quintó LI, Taurina A, Vera M, Piera C, Darnell A: Serum cystatin Casa new marker ... marker of acute renal dysfunction in critically ill patients Crit Care 2005, 9:R139-R143 O’Riordan SE, Webb MC, Stowe HJ, Simpson DE, Kandarpa M, Coakly AJ, Newman DJ, Saunders JA, Lamb EJ: Cystatin...
... 5'-ACTGAACCTGACCGTACACGCTCAGGCGCAATCAC-3' KAN reverse: 5'-CCAGCCATTACGCTCGTCAT-3' Standard Curves and Background Detection To determine the relative copy numbers of KAN and FIV from plasma samples, ... GCATATAATAAAGTGGGTACCACTACAACATTAG-3'), which adds an NdeI restriction site, methionine, and alkaline to the N-terminal of the protease and 3' primer MFIVCPL33' (5'-CTGAGATCTGAGCAAGCTTTTACATTACTAATCT AATATTAAATTTAACCATG ... DNA (cDNA) was synthesized from isolated plasma viral RNA of infected cats The cDNA pool was used asa template for PCR reactions using 5' primer MFIVCPL5' (5'-GATTTATAAATCATATG GCATATAATAAAGTGGGTACCACTACAACATTAG-3'),...
... epiphyseal hard and soft tissues and articular cartilage [19], matching Sokoloff's concept of degenerative joint disease asa deranged tricompartmental articulation [23] The articular aspect demonstrates ... reparative activities that are conventionally accepted as the epitome of revitalization of avascular dead bone Investigators have a priori endeavored to enable vascular ingrowth Accepting that ... para-articular apparatus of rats with osteonecrosis are loaded with VEGF Secondly, an additional hastening of the already hurried revascularization and remodeling of the necrotic femoral head...
... least 59 This protein identification criterion refereed research Recalibration algorithm for increased mass accuracy under space charge conditions Peptide identification via Mascot database search ... human keratins) A 'decoy database' was prepared by sequence reversing each entry and appending this database to the forward database Search parameters specified a MS tolerance of 10 ppm (see above) ... mass accuracy, the 99% significance threshold (p < 0.01) in the yeast database search was a Mascot score of 29 (Mascot peptide score is defined as -10 × log(p) where p is the probability ofa false...
... transformed data A p-value < 0.05 was regarded as statistically significant Abbreviations A/ E, attaching and effacing; AP, activator protein; AQP, aquaporin; CA, carbonic anhydrase; CFTR, cystic ... commensal microbiota biases Animals were housed in microisolator cages in a specific pathogen-free facility approved by the Association for Assessment and Accreditation of Laboratory Animal Care ... (Invitrogen, Carlsbad, CA, USA) RNA was treated with DNase I and purified using an RNeasy Clean-up kit as recommended by the manufacturer (Qiagen, Valencia, CA, USA) The total RNA concentration and 260/280...
... sequence: gcctaccatggtgccttcttatg, 3′ sequence: tatgcttgtcatcgtcgtccttgtagtcac) 11 consisted ofa minute denaturation step at 94oC and 34 cycles of 94oC for 20 s, 58oC for 30 s, and 72oC for ... decreased skin capacitance in areas adjacent to the application sites, as far as approximately 0.75cm away (Patil, Singh, & Maibach, 1995) It appears that SLS acts in a time-and-dose dependent manner ... in school or work, and an increase in parental and child morbidity The clinical features of AD include mild cases of erythema in localized areas of the body to acute lesions that appear as erythematous...
... resonance decaying in a top-antitop pair, using ATLAS data at center -of- mass √ energy of s = TeV The latter analysis is repeated for ATLAS data col√ lected with s = TeV Performance studies of b-tagging ... on a rational and objective analysis over experimental evidence A current modelof matter that is able to predict a large amount of phenomena with excellent accuracy is called the Standard Model ... (where σ a are the Pauli matrices); α(x) is an arbitrary three2 component vector of functions of the space-time; β(x) is an arbitrary function of the space-time The Lagrangian can be made invariant...
... RT-PCR, in which 5’-accatgtccccgctgtgcct-3’ and 5’-tcaatagcacttgcagtaga-3’ were used as forward and reverse primers for syncollin while 5’-cgaggcgcttgtccagtgcc-3’ and 5’-tcaatagcacttgcagtaga-3’ ... pIRES-Rac1 5’ flank c- my tagged Rac1 pCDNA pCDNA3. 1A/ Myc-His pCDNA-syncollin Syncollin was cloned in pCDNA3. 1A pCDNA-truncated syncollin Truncated syncollin was cloned in pCDNA3. 1A 2.2.4 Transformation ... membrane ruffling require active actin polymerization at the plasma membrane A number of Rac effectors act as regulators of actin polymerization The p21activated kinase (PAK) that is activated...