soil management for the establishment of the forage legume arachis pintoi as a mean to improve s
Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems
... the systems ability to recover the information successfully In fading channels, where the instantaneous SNR is a random variable, the average SNR is used as the measure Another standard measure ... lu is the channel gain and τlu is the total delay of the l th signal path of user u The total delay consists of the path delays and the asynchronous access delays between users Therefore the ... analysis was performed for a synchronous TH-UWB and an approximated PDF of the interference was used for asynchronous case An approach assuming rectangular mono-pulse shape has been presented...
- 104
- 421
- 0
Tài liệu Challenges of water resources management for downstream livelihood of the lower Mekong delta, VietNam pdf
... The losses of clam stocks were one of the biggest problems in the coastal area The reason for the losses was unknown and this creates a lot of frustration in the area Extensive shrimp cultivation ... Some farmers thought that one of reasons causing losses of clam stocks and clam death was worsen water from upstream Farmers informed that natural clam stocks were disappeared from Ong Mao island ... Erosion has been very strong in the coastal areas, caused mainly by tidal fluctuation, storms, possibly also because of the destruction of mangrove forest Many farmers lost their land by erosion...
- 7
- 513
- 1
fundamentals of sales management for the newly appointed sales manager
... One of the issues faced by a new sales manager is the fact that the manager is now a team player on the management team as well as the team leader of the sales team This dual capacity creates some ... core areas of skills: The communication and interpersonal skills necessary to carry out sales A mastery of the sales process and how it relates to the business Fundamental business competency A solid ... manager and a salesperson By covering some of the critical areas of selling, the book will help you develop your staff as a manager as well as fine-tune many of the skills you already possess as...
- 225
- 528
- 0
Comparison of cosmetic earnings management for the developed markets and emerging markets some empirical evidence from the united states and taiwan
... data adjustment of financial reports ultimately affects the assessment of a firm by outside stakeholders Several studies have shown that managers have an incentive to manipulate earnings to reach ... provides the basis for the numerical analysis of a sequence of numbers of a similar nature The deviation in actual data from these expected frequencies indicates the presence of manipulation (Thomas, ... Benford 's law and earnings management The earnings management issue has become a concern throughout the world (Islam et al., 2011) Earnings management is the managerial use of procedures to adjust...
- 8
- 405
- 0
Workflow Management for the Grid
... and manipulated using XML standards Transformations within activities are expressed with XSLT [12] and XPath [13] The use of XML as the data format and XML Schema [14] as the associated ... between tasks, updating the processes as tasks complete or fail, and taking appropriate actions in response The scheduler-based paradigm has been widely used However, there are two alternative paradigms, ... data transfers to visualization servers or archiving of large data sets to mass storage Task scheduling is implemented using Titan, which focuses on the sub-workflow and workflow levels of management...
- 34
- 421
- 0
Tài liệu PROJECT APPRAISAL AND RISK MANAGEMENT FOR THE PUBLIC SECTOR pdf
... Program, 2004-2005 The Appraisal of Development Expenditures Project appraisal and risk management for the public sector BASIC NEEDS ANALYSIS SOCIAL ANALYSIS ECONOMIC ANALYSIS FINANCIAL ANALYSIS ... project Should maintain same quality of information across all variables Whenever possible should use secondary information Biased information better than mean values KEY QUESTION a Is this project ... MARKET ANALYSIS TECHNICAL ANALYSIS RESOURCES ANALYSIS ECONOMIC ANALYSIS FINANCIAL ANALYSIS - Cao Hao Thi + - REJECT ? + ? ACCEPT Fulbright Economics Teaching Program, 2004-2005 The Appraisal of...
- 9
- 739
- 2
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... problem, many measures would be suggested. The responsibility of the scientists is to screen among these alternatives the feasible measures based on applicability and suitability for the local conditions. ... 2.7. Selection of the feasible measures The final stage in the decision making process is to estimate the scores for each of the alternatives and choose the most suitable measures for the objectives and conditions of ... is necessary to have more precise data and a wider range of stakeholders serving for the assessment task. 5. Conclusions 4. Discussions The application results of MCA method to the problem of brackish shrimp pond culture ...
- 13
- 487
- 0
Quality Management for the Technology Sector pptx
... obviously dissatisfied internal and external customers) What can Defense Systems Associates to turn a bad situation around? The management of Defense Systems Associates understands that they have a ... be as complex as performing a quality function deployment analysis, or as simple as listening to the customer Satisfying the customer has to be a paramount concern, as dissatisfied customers represent ... prepared for Defense Systems Associates to show individual customers within the customer organization (in this case, the U .S Army), and their supplier counterparts in Defense Systems Associates~...
- 219
- 471
- 0
Farm Business Management for the 21st Century: Checking Your Farm Business Management Skills pot
... University, 1998 Raises several strategic management issues for farm business managers A series of exercises that leads a reader through the strategic planning process is also available by contacting ... funds and good capital investment decisions Financial management also addresses the use of tax management strategies; the use of insurance to protect against financial losses that can arise from ... essential to honestly assess your managerial skills and capacities, and to improve those skills if your assessment indicates that you come up short or are vulnerable The successful farm business of the...
- 12
- 506
- 0
Báo cáo hóa học: " Uniqueness of the potential function for the vectorial Sturm-Liouville equation on a finite interval" doc
... H) The authors want to emphasis that for n = 1, the result is classical; for n = 2, Theorem 2.6 leads to Theorem 1.1 Shen also shows by providing an example that minimal number of spectral sets ... contributed to each part of this work equally and read and approved the final version of the manuscript Competing interests The authors declare that they have no competing interests Received: 28 April ... generalize the above theorem for the case m ≥ The idea we use is the Weyl s matrix for matrix-valued Sturm-Liouville equation Y + (λIm − Q(x))Y = 0, < x < π (1:5) Some uniqueness theorems for vectorial...
- 8
- 391
- 0
RISK MANAGEMENT FOR THE FUTURE – THEORY AND CASES potx
... selected as the pilot area for the establishment of a sample fire database based on Geographic Information System (GIS) and as the basis of sample spatial queries in support of fire management Specifically, ... risk assessments offer value Accept uncertainty: uncertainty enters risk assessment as assumptions, estimates and subjective judgments and lack of precise information Even in quantitative assessments ... two of the four categories A risk assessment tool will be qualitative or quantitative and formatted as tree or spread sheet This leads to a classification matrix as shown in Table Analysis formatted...
- 510
- 1,291
- 1
State management for the publishing activities in vietnam
... criteria, consisting of the effectiveness, efficiency, appropriateness and sustainability of state management - The Dissertation has evaluated the strengths and weaknesses of state 24 management ... publishing activities 2.2.1 Assessment by criteria of state management 2.2.1.1 Assessment of the effectiveness of state management on publishing activities The effectiveness of state management ... From that, the Dissertation has specified the objectives of publishing activities and the assessment criteria of state management on publishing activities - The Dissertation has analyzed the content...
- 14
- 359
- 0
SOLUTIONS FOR THE HAI CHAU CONFECTIONERY COMPANY’S PRODUCT STRATEGY TO PROMOTE CUSTOMER SATISFACTION
... Iodized seasoned salt is very essential in every Vietnamese family, produced as a result of the Vietnam-Australia National program of anti-insufficient disease lodine, can supply a certain amount ... market share in the severely competitive market, a study is conducted based on analysis of the company s product strategy and its customer s feedback The study was approved by the head of the company s ... this, it is also easy for us to withdraw solutions for the company Next, based on the preceded analysis, recommendations are given with some helpful solutions for the Hai Chau company Finally,...
- 5
- 648
- 6
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... lactis ald gene as follows A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) ... was used for integration of synthetic promoters upstream to the las operon The plasmid pLB85 harbouring attP of TP901-1 and a promotorless gusA gene encoding b-glucuronidase [21] was used as ... work was supported by the Danish Dairy Research Foundation (Danish Dairy Board), the Danish Research Agency and the Danish Center for Advance Food Studies (LMC) 2301 Control analysis of the las operon...
- 12
- 616
- 0
Tài liệu The Economic Promise of Investing in High-Quality Preschool: Using Early Education to Improve Economic Growth and the Fiscal Sustainability of States and the Nation pptx
... degrees, teachers with specialized training in early education, assistants with Child Development Associate (CDA) credentials, teachers and assistants receiving at least 15 hours of in-service training ... Washington have proposed funding increases despite budget deficits In addition, policymakers in Nebraska, North Carolina, Arkansas, and Massachusetts have expanded access, improved quality, increased ... analyses, estimates of fiscal benefits that only include the savings and revenues that affect states and exclude the benefits to individuals (such as increased earnings) continue to demonstrate...
- 74
- 608
- 0
Tài liệu Analysing different technology pathways for the pulp and paper industry in a European energy systems perspective doc
... Johanna Jửnsson 0.214 was used as a base case; and for the case when the mill was modelled within the same system boundary as a utility, Papers I-III, a capital recovery factor of 0.1 was used as ... is assumed that the excess heat exported from the studied system will be used as part of the base load in a district heating system and thus affect the building of base load capacity The district ... assessing a mills steam balance, assuming only a limited amount of data, is developed and applied to a case study It is investigated which energy-related data are publicly and/or easily accessible...
- 124
- 648
- 0
look at the important information in this header.1look at the important information in this header.We encourage you to keep this file on your own disk, keeping an electronic path open for the next readers. Do not remove this. **Welcome To The World o doc
... in the Couvent des Anglaises at about the same time as Maurice de Saxe 's granddaughter It was in this way that the fusion of classes was understood under the Terror She was employed as a figurante ... us of Madame Marie-Xavier, and of her despair at having taken the vows; of Sister Anne-Joseph, who was as kind as an angel and as silly as a goose; of the gentle Marie-Alicia, whose serene soul ... over The boundless hopes and the enthusiasm of 1831 were things of the past "The Republic, as it was dreamed of in July," she writes, "has ended in the massacres of Warsaw and in the holocaust of...
- 94
- 670
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase ... lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student s paired t-test (a ¼ 0.05) with the Bonferroni adjustment was used to ... denaturation assay, using lysates of K562 cells (data not shown) Discussion Whereas the importance of HSPs in the pathogenesis of many diseases is well established together with their potential...
- 10
- 452
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25