... proteins is likely attributable, in part, to the increased miRNA targeting that results inthe down-regulation of these transcripts On the one hand, the majority ofthedisorderedproteins have ... decay rates to the Ensembl protein identifiers of our dataset of human proteins This gave a dataset of 3,839 proteins, each of which has an associated experimentally determined mRNA decay rate ... avoidances are evident by an increase in protein stability for some disorderedproteins Separately, they also found a correlation between decay rates and mRNA stability fordisordered proteins, in agreement...
... according to the protein concentration so as to ensure the same statistical accuracy for all measurements after averaging No protein aggregation was observed during the SANS experiments Data analysis ... contained ina high-pressure cell made of stainless steel with two parallel thick sapphire windows The optical path length was mm and the maximum forward scatteringangle hmax ẳ 15 A separator between ... D., Durand, D., Calmettes, P & Desmadril, M (2001) Characterization ofthe denatured states distribution of neocarzinostatin by small- angleneutronscattering and dierential scanning calorimetry...
... concentration at arbitrary locations in spacetime In [12], [13] this was achieved by translating the origin inthe integrand of (1.6) to an arbitrary point y, and averaging against the L1 mass density ... data were shown in Kapitanski [25], Shatah-Struwe [39] For an analog ofthescattering statement in Corollary 1.2 forthe critical wave equation; see Bahouri-Shatah [2], Bahouri-G´rard [1] for ... and Jalal Shatah for interesting discussions related to the interaction Morawetz estimate, and Jean Bourgain for valuable comments on an early draft of this paper, to Monica Visan and the anonymous...
... interpretation ofthe proposition containing the clue, and hence facilitating t h e analysis for that proposition As outlined in section 2.1, the analysis ofa proposition involves a constrained ... Dy a clus suggesting its link to i, then the hearer is spared the long chain of trying as evidence for 7, and So, linear time algorithms can become real time with the aid of clues (EX 3) But there ... may have to be considered Here, finds as its father 4)Summary: We note that some phrases of summary are used ina reformulation sense and would be analyzed according to that category's rules These...
... Page for torsion angle statistics ina single mode Figure 5.4: STARS user interface – (a) Page for interatomic distance statistics ina batch mode (b) Page for torsion angle statistics ina batch ... signal decay away rapidly owing to the relaxation ofthe magnetization Transverse relaxation is the main source for this signal loss For large proteinsthe signal decays much faster, which causes ... functional states and play an important role in catalysis, where conformational rearrangements can juxtapose key catalytic residues; in ligand binding, which often involves the entry of molecules into...
... specialization in mathematics is also needed Ina nutshell, we say that the more mathematics, the better; however, one should not fall into the trap of confusing an economist with a mathematician! ... These are your main objective inthe first year (after learning all the material, of course) Instructors don’t care if you got an A+ or a C- as long as you These are also known as core examinations, ... depends on the institution In some cases you are allowed to repeat the examinations within a certain limit of trials (like in Minnesota) In others, failure to pass may mean being suspended from the...
... p47phox and Rac was maintained at a value of 4, i.e a nonsaturating concentration with respect to p47phox and Rac2 (cf Fig 3A) The concentration of flavocytochrome b was maintained at a fixed value, and ... SDS/PAGE Coomassie blue staining ofthe gel shows an enrichment ofthe DEAEI fraction inthe two components ofthe S10 0A8 /A9 protein with molecular masses of kDa and 23 kDa and the disappearance of ... GTPcS-loaded Rac2, MgSO4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the...
... protected area on the Da Lat Plateau The park was first designated as a nature reserve in early 1986 and then later upgraded to national park in 2005 Chu Yang Sin is a system of mountains running from ... inthe Eastern Paleotropics Socialist Republic of Vietnam – a country situated in South East Asia – with high temperature, high average annual rainfall and large area of primary tropical rain forests ... Publications 65 LIST OF FIGURES AND TABLES Fig Location of Chu Yang Sin national park in Vietnam Fig Map of Chu Yang Sin national park Fig Habit and ascospores of Arthonia cyanea var...
... and chromatography Increasing the fraction of solvent B as shown in Table the analytes can be eluted from the RAM Phase and separated at the analytical column before detection After all analytes ... switching method was optimized forthe automation of sample clean-up and enrichment forthe analysis of inflammatory markers in EBC There was no control material commercially available Therefore ... by diluting thesolution with ammonium acetate 10 mM Linear calibration curves were obtained by plotting the quotients ofthe peak areas of each analyte with the assigned internal standard [2H4]...
... state space ofthe difference between observed and calculated heads at specified observation points The main advantage ofthe output least-squares methods are that the formulation ofthe inverse ... 0.3.7 Singular perturbation Inthe article [5] Alessandrini has proposed a singular perturbation technique to determine the spatially varying coefficient inthe special case f = inthe partial differential ... solve the linear matrix equation which arises from discretization of (0.19) and application ofa necessary optimality condition An alternative approach can be based on the weak formulation of (0.19)...
... One ofthe advantage of our approach is that the above minimization problems are convex and we can find their global minima Furthermore, taking their solutions as the regularized solutions to the ... regularized solution to the inverse problem On ρ the other hand, the problem ∫ | a| a ΠAad (u) (Ka ) Ω also has a solution, which is called the total variation-minimizing solutionof equation U (a) ... the regularization parameter Theorem 4.2.1 shows that problem (Pa ) has a unique solutiona On the other hand, ρ ρ,δ the problem ∫ a 2 (Ω) + | a| , (Ka ) L a ΠAad (u) Ω also has a unique solution...
... ACCATGGACAAGAATTTT CGTG and GATATTGAGTTTCTCCAGAACTTTG (AtPum14); CACCATGGCAGTCGCTGATAATCCC and GCAACGAAGCCTAATGAGTCCAAG (AtPum18); CA CCATGGTTTCTGTTGGTTCTAAATCAT and AATT CTCATTTTATTTGAATGCCGA ... CACCATGGGTTTTGGAGGTTTTAATG and CTTC TTCAAGATGGTCTTG (AtPum9); TGCATGGAGA TTTTTAACTTCGGAC and CTTCTTCAAGATGGTC TTGGAGAAAATC (AtPum10); GAGATGGATCAGA GAAGAGGAAATG and CTTCTTCGAGCTAAGTGCG GAGAGG (AtPum12); ACCATGGACAAGAATTTT ... encode the full-length AtPum protein The PCR primers used were: AAGATGGATGAGTTTCGTGAAG and CTTCTTCAATAGATTCC TCGAGAAA (AtPum7); CACCATGATGAGAGGTGAA TTTGG and ATTCTTCAAGAGATTTCGTG (AtPum8); CACCATGGGTTTTGGAGGTTTTAATG...
... 102.01-2014.02, and a part of it was done when he was working as a research professor at the Vietnam Institute for Advanced Studyin Mathematics (VIASM) He would like to thank the VIASM for providing a fruitful ... initiated, for providing a pleasant and fruitful working atmosphere In addition, the authors would like to thank the Hausdorff-Center for Mathematics (HCM) and the Bonn International Graduate ... that there is a continuous embedding from X into Y The relation an bn means that there is a constant c > independent ofthe context relevant parameters such that an ≤ cbn for all n belonging...
... demonstrate how to apply the principles of bhakti yoga that he had taught inthe Bhagavad Gita Chaitanya specifically espoused the chanting ofthe Hare Krishna mantra: Hare Krishna Hare Krishna, Krishna ... later than their initial inception inthe countries of origin Soka Gakkai which formed in Japan inthe 1930s, but initiated a presence in Singapore in 1960 through a Japanese expatriate and the Jehovah’s ... spread the chanting of Krishna’s names all over the world and that ‘fair skinned foreigners will come to Mayapur (the birthplace of Chaitanya)’ and join Bengali Vaishnavas inthe congregational...
... exist in zymogens In initial stage, the caspase or caspase 10 is activated and later they activate other caspases ina cascade This cascade eventually leads to the activation ofthe effector caspases, ... F-type ATPases contain an integral membrane domain (F0) acting as H+ channel and a peripheral domain (F1), which is of importance for both ATP-synthase and ATPase activity This type of ATPases plays ... decrease in total plasma antioxidant capacity measured in terms of FRAP values [156] 2 Theoretical background 27 2.5.4 Relevance of ageing and apoptosis The ageing of RBCs leads to the binding of...
... subsidiaries of multinational organizations across national boundaries makes many organisations to view the management of expatriates as a critical part of their international human resource management ... tools inthe effort to create a translational mindset inthe organisation Failure to disseminate the individual learning gained from a foreign assignment to others inthe organisation is a barrier ... being in Vietnam The slow pace of Hanoi life and the feeling being ina country side even I am actually ina city, the absence of skyscrapers is actually very comforting and relaxing at the same...
... support a basic approach forthe development of inhibitors/activators of CSE Currently no small molecule activators of CSE are available BCA and PAG are probably the best available inhibitors for ... phosphorylation and activation of three kinases, namely, MAP kinase kinase kinase (MAPKKK or MAP3K or MEKK), MAP kinase kinase (MAPKK or MAP2K or MEK) and MAP kinase (MAPK) (Figure 17) Phosphorylated/activated ... mitogen activated protein kinase (MAPK) signalling cascade (Zwick et al., 2001) Mitogen Activated Protein Kinase (MAPK) pathways make up the backbone of signal transduction machinery within the cells...
... preceding or following paragraph The most important idea is always placed at the beginning ofa paragraph Disregarding time order, the reporter can arrange his material inthe descending order of ... Goalie saves Australia in China The topic sentence: KUNMING, China: Mark Schwarzer saved Shao Jiayi’s penalty two minutes from time as Australia held China, 0-0, Wednesday to collect a valuable ... item ofthe goods The value for exchange of press in general and news story in particular is shown inthe way the journal or the magazines itself perform People pay money fora journal in order...