skills and competencies required by a project manager
Project Gutenberg''''s Darwin and Modern Science, by A.C. Seward and Others pot
Ngày tải lên :
28/06/2014, 19:20
... years which I spent at
Cambridge my time was wasted, as far as
the academical studies were concerned, as
completely as at Edinburgh and at school."
"In order to pass the B .A. Examination, ... the
translation of Prof. Strasburger's essay
Madame Errera of Brussels rendered
valuable help. Mr Wright, the Secretary of
the Press Syndicate, and Mr Waller, the
Assistant Secretary, have ... H.M.S. 'Adventure'
and 'Beagle'"
Publication of the "Zoology of the Voyage
of H.M.S. 'Beagle'", Part II., "Mammalia",
by G.R. Waterhouse,...
- 2.4K
- 446
- 0
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt
Ngày tải lên :
07/03/2014, 00:20
... a project manager can and must influence through-
out the project trajectory. In contrast, Barki et al. observed
risk dimensions that are beyond managers' operational
control and which managers ... improve
the manuscript and the analysis. We are also grateful to Esko
Leskinen and Kari Heikkinen for their advice on statistical
analyses. Thanks go also to Mark Keil and Lars Mathiassen
for their ... Shaping
and Software Risk A Categorical Analysis of Four Classical
Approaches,º Information Systems Research, vol. 9, no. 3, pp. 233-
255, Sept. 1998.
[35] J. March and Z. Shapira, êManagerial...
- 15
- 665
- 0
modeling of chemical kinetics and reactor design by a. kayode coker
Ngày tải lên :
01/04/2014, 10:25
... temperature. Table 2 shows the raw
materials requirements, yield, and properties of ammonia.
Transportation is by railroad tank vehicle, by tank truck, or by
pipeline. In this case, transportation at ambient ... factors that deter-
mines the storage method is the quantity of ammonia to be stored.
Ammonia is toxic and flammable, although the lower flammable
limit is quite high and fires in ammonia facilities ... both academic and industrial research organizations have enabled
these groups to review the state of the art and cooperate with the
overall objectives of improving the safety, yields, and quality...
- 1.1K
- 7.5K
- 0
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf
Ngày tải lên :
18/06/2014, 18:20
... 22:477-481.
32. Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody-forming
cell responses in the nasal-associated lymphoid tissue of
mice vaccinated by intranasal, intravenous and/ or subcuta-
neous administration. ... T,
Aizawa C, Nakagawa M, Kurata T: Functional role of respiratory
tract haemagglutinin-specific IgA antibodies in protection
against influenza. Vaccine 1990, 8:479-485.
31. Tamura SI, Asanuma ... Hori-
zontal bars show GMTs within distinct immunization protocols. Data were ana-
lyzed by ANOVA and Tukey's Multiple Comparison post test and marked as in
A.
Ab response and protection after various...
- 14
- 515
- 0
Báo cáo hóa học: " Bi-Functional Silica Nanoparticles Doped with Iron Oxide and CdTe Prepared by a Facile Method" doc
Ngày tải lên :
22/06/2014, 00:20
... Tianjin Shuangchuan Chemical
Reagent Factory, China. TEOS was purchased from Tianjin
Chemical Reagent Company, China. 3-aminopropyltrime-
thoxysilane (APTMS) was commercially available from
Fluka. Other ... spectra (FT-IR), and fluorescent microscopy. The
characterization results showed that the final nanomaterial
possessed a saturation magnetization of about 5.8 emu g
-1
and an emission peak at 588 nm when ... brightness, narrow and size-tunable emission,
fairly high quantum yields, and good chemical and photo
stability. These properties make CdTe nanocrystals suitable
for biological applications, fabricating...
- 6
- 240
- 0
Báo cáo y học: " HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector" ppt
Ngày tải lên :
10/08/2014, 05:20
... reverse: 5'-cgccaacatagaccaccttttc)
and CCR5 (forward: 5'-caaaaagaaggtcttcattacacc and
reverse: 5'-cttgctcgctcgggagcctc) (IDT, Coralsville, IA) were
used to determine transcript ... (Promega),
was used to visualize the bands.
RT-PCR
Total RNA was extracted from non-transduced and trans-
duced cells. Primers specific for CXCR4 (forward: 5'-ggag-
gggatcagtatatacacttc and ... actin
as an internal control. A secondary antibody, goat anti-
rabbit IgG conjugated with alkaline phophatase
(Promega, Madison, WI), was then added. An alkaline
phophatase substrate reagent, Western...
- 12
- 276
- 0
Báo cáo y học: "Objective Structured Clinical Examinations (OSCEs), psychiatry and the Clinical assessment of Skills and Competencies (CASC)Same Evidence, Different Judgement" ppsx
Ngày tải lên :
11/08/2014, 15:22
... long
cases with each long case involving a partly observed
interview of a real patient. Part II also involved an oral
examination involving some standardized patient man-
agement problems.
Authors ... difficulty and features of a
patient [34].
Testing context can significantly predict performance
in an OSCE [35]. Therefore focussing a candidate on a
particular area at a CASC station may in itself ... checklists and global rating scales for assessing
performance on an OSCE-format examination. Academic Medicine 1998,
73:993-7.
20. Carraccio C, Englander R: The objective structured clinical examination:...
- 6
- 324
- 0
4 Creating a Configuration and Physical Standby Database by Using Enterprise Manager
Ngày tải lên :
04/11/2013, 11:15
... Standby
Database by Using Enterprise Manager
Copyright â 2006, Oracle. All rights reserved.
4 - 11
Step 3: Select the Standby Database Location
Instance Name
Copyright â 2006, Oracle. All ... Oracle. All rights reserved.
4 - 6
Creating a Configuration
Click “Add Standby Database” to
start the wizard.
Copyright â 2006, Oracle. All rights reserved.
4 - 15
Step 5: Specify Standby Database ... operations are executed.
ã
Temporary tablespaces and temporary segments are not
logged.
ã
FORCE LOGGING is recommended for both physical and
logical standby databases.
ã
Issue the following command...
- 24
- 397
- 0
Charles Frohman: Manager and Man, by Isaac1Charles Frohman: Manager and Man, by IsaacThe Project Gutenberg eBook, Charles Frohman: Manager and Man, by Isaac Frederick Marcosson and Daniel Frohman, et al This eBook is for the use of anyone anywhere at pot
Ngày tải lên :
23/03/2014, 05:20
... (http://www.gutenberg.net/dirs/2/6/1/4/26146/26146-h.zip)
CHARLES FROHMAN: MANAGER AND MAN
by
ISAAC F. MARCOSSON and DANIEL FROHMAN
With an Appreciation by James M. Barrie
Illustrated with Portraits
New York and London Harper & Brothers ... FITCH
HENRY ARTHUR JONES
W. LESTOCQ
CHARLES DILLINGHAM
MAUDE ADAMS
MAUDE ADAMS
FRANCIS WILSON
WILLIAM COLLIER
MARGARET ANGLIN
Charles Frohman: Manager and Man, by Isaac 3
Thus it came about that for ... became treasurer of the company. Alf Hayman, whom Frohman had met in Philadelphia, was engaged as
advance-agent.
It was a courageous undertaking even for a seasoned and well-financed theatrical...
- 232
- 496
- 0
A handbook for project managers, developers, implementers, evaluators and donors working to counter trafficking in persons. ppt
Ngày tải lên :
30/03/2014, 01:20
...
approximately 100 victims of tracking in Africa, Asia (excluding Australia, Japan and New Zealand),
Latin America and the Caribbean who are unable to access adequate support through any other ... El-Dardiry, Christophe
Franzetti, Lidia Futter, Harvy Gadia, Ashley Garrett, Tatiana Ivanyuk, Frank Laczko, Fred Larsson, Par Liljert,
Amy Mahoney, Agueda Marin, Jonathan Martens, Ruzayda Martens, ... that it is treated with the utmost care and condentiality. All disclosures of personal data both
within and outside an organization should be carefully evaluated on a case by case basis. Data...
- 80
- 376
- 0
Research and Writing Skills Success in 20 mins a day
Ngày tải lên :
18/03/2013, 01:45
... that
analyzes a particular topic or book, while a
research paper involves analyzing raw data and
different facts and statistics from a variety of
sources. Once you have collected all your materi-
al, ... materi-
al, you will learn how to use it as the basis for a
persuasive argument. You will also learn how to:
■
Arrange and organize all your data and
information in a logical sequence.
■
Prepare ... is helpful and
handy because
a. note cards can be arranged easily and
quickly and stored in one place.
b. note cards are a more respected way of
taking down information.
c. note cards look more...
- 139
- 588
- 9
Tài liệu Creating a Logical Standby Database by Using Enterprise Manager ppt
Ngày tải lên :
09/12/2013, 16:15
... Logical Standby Database
with Enterprise Manager
Click “Add Standby Database.”
7
Copyright â 2006, Oracle. All rights reserved.
Creating a Logical Standby Database by Using
Enterprise Manager
...
the database.
–
STANDBY: prevents users from making changes to any
data maintained by Data Guard SQL Apply.
NONE: normal security
ã
Query GUARD_STATUS column in V$DATABASE.
ã
Database guard level ... Logical Standby Database
ã
Configure the database guard to control user access to
tables.
ã
ALTER DATABASE GUARD command keywords:
ALL: prevents users from making changes to any data in
the database.
–
STANDBY:...
- 29
- 496
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2